chr12-102958393-C-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_004316.4(ASCL1):c.154_186dupCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG(p.Gln52_Gln62dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_004316.4 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- phenylketonuriaInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Myriad Women’s Health
- classic phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- maternal phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- mild hyperphenylalaninemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- mild phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- tetrahydrobiopterin-responsive hyperphenylalaninemia/phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004316.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ASCL1 | NM_004316.4 | MANE Select | c.154_186dupCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG | p.Gln52_Gln62dup | conservative_inframe_insertion | Exon 1 of 2 | NP_004307.2 | ||
| PAH | NM_001354304.2 | c.-327_-295dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | 5_prime_UTR | Exon 1 of 14 | NP_001341233.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ASCL1 | ENST00000266744.4 | TSL:1 MANE Select | c.154_186dupCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG | p.Gln52_Gln62dup | conservative_inframe_insertion | Exon 1 of 2 | ENSP00000266744.3 | ||
| PAH | ENST00000547319.1 | TSL:4 | n.-16_17dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | non_coding_transcript_exon | Exon 1 of 3 | ||||
| PAH | ENST00000551337.5 | TSL:3 | c.-327_-295dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | upstream_gene | N/A | ENSP00000447620.1 |
Frequencies
GnomAD3 genomes AF: 0.0000200 AC: 3AN: 150120Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000737 AC: 10AN: 1356952Hom.: 0 Cov.: 17 AF XY: 0.0000120 AC XY: 8AN XY: 669242 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.0000200 AC: 3AN: 150120Hom.: 0 Cov.: 0 AF XY: 0.0000137 AC XY: 1AN XY: 73222 show subpopulations
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at