chr12-111598976-TGTTGCTGCTGCTGCTGCTGCTGCTGCTGC-T

Variant names:

• chr12-111598976-TGTTGCTGCTGCTGCTGCTGCTGCTGCTGC-T
• rs756277324
• NM_001372574.1:c.30_58delGCAGCAGCAGCAGCAGCAGCAGCAGCAAC

Variant summary

Our verdict is Likely benign. Variant got -2 ACMG points: 2P and 4B. PP5_Moderate BS2

The NM_001372574.1(ATXN2):​c.30_58delGCAGCAGCAGCAGCAGCAGCAGCAGCAAC​(p.Gln11AlafsTer69) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000137 in 1,433,322 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. Q10Q) has been classified as Uncertain significance.

• Frequency:
  • Genomes: 𝑓 0.00016 (0 hom., cov: 30)
  • Exomes 𝑓: 0.00013 (0 hom.)
• Consequence: ATXN2 NM_001372574.1 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.93

Genes affected

ATXN2 (HGNC:10555): (ataxin 2) This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]

ACMG classification

Verdict is Likely_benign. Variant got -2 ACMG points.

• PP5: Variant 12-111598976-TGTTGCTGCTGCTGCTGCTGCTGCTGCTGC-T is Pathogenic according to our data. Variant chr12-111598976-TGTTGCTGCTGCTGCTGCTGCTGCTGCTGC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 3779390.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High AC in GnomAd4 at 24 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATXN2	NM_001372574.1	c.30_58delGCAGCAGCAGCAGCAGCAGCAGCAGCAAC	p.Gln11AlafsTer69	frameshift_variant	Exon 1 of 25	ENST00000673436.1	NP_001359503.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATXN2	ENST00000673436.1	c.30_58delGCAGCAGCAGCAGCAGCAGCAGCAGCAAC	p.Gln11AlafsTer69	frameshift_variant	Exon 1 of 25		NM_001372574.1	ENSP00000500925.1

Frequencies

GnomAD3 genomes AF: 0.000163 AC: 24 AN: 147058 Hom.: 0 Cov.: 30

Gnomad AFR AF: 0.000181

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000269

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000164

Gnomad OTH AF: 0.000976

GnomAD4 exome AF: 0.000134 AC: 172 AN: 1286264 Hom.: 0 AF XY: 0.000140 AC XY: 89 AN XY: 635254

Gnomad4 AFR exome AF: 0.000239

Gnomad4 AMR exome AF: 0.000128

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000162

Gnomad4 SAS exome AF: 0.0000281

Gnomad4 FIN exome AF: 0.0000269

Gnomad4 NFE exome AF: 0.000140

Gnomad4 OTH exome AF: 0.000169

GnomAD4 genome AF: 0.000163 AC: 24 AN: 147058 Hom.: 0 Cov.: 30 AF XY: 0.0000835 AC XY: 6 AN XY: 71846

Gnomad4 AFR AF: 0.000181

Gnomad4 AMR AF: 0.000269

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000164

Gnomad4 OTH AF: 0.000976

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Spinocerebellar ataxia type 2 Pathogenic:1

Jul 21, 2022

Department of Pathology and Laboratory Medicine, Sinai Health System

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs756277324; hg19: chr12-112036780;