chr12-111598978-TTGCTGCTGCTGCTGCTGCTGC-T

Variant names:

• chr12-111598978-TTGCTGCTGCTGCTGCTGCTGC-T
• rs193922927
• NM_001372574.1:c.36_56delGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001372574.1(ATXN2):​c.36_56delGCAGCAGCAGCAGCAGCAGCA​(p.Gln13_Gln19del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000173 in 1,155,346 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000017 (0 hom.)
• Consequence: ATXN2 NM_001372574.1 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.93
• Publications: 2 publications found

Genes affected

ATXN2 (HGNC:10555): (ataxin 2) This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]

ATXN2-AS (HGNC:51838): (ATXN2 antisense RNA)

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001372574.1

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATXN2	NM_001372574.1	c.36_56delGCAGCAGCAGCAGCAGCAGCA	p.Gln13_Gln19del	disruptive_inframe_deletion	Exon 1 of 25	ENST00000673436.1	NP_001359503.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATXN2	ENST00000673436.1	c.36_56delGCAGCAGCAGCAGCAGCAGCA	p.Gln13_Gln19del	disruptive_inframe_deletion	Exon 1 of 25		NM_001372574.1	ENSP00000500925.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000173 AC: 2 AN: 1155346 Hom.: 0 AF XY: 0.00000176 AC XY: 1 AN XY: 568206

African (AFR) AF: 0.00 AC: 0 AN: 24914

American (AMR) AF: 0.00 AC: 0 AN: 27174

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 22082

East Asian (EAS) AF: 0.00 AC: 0 AN: 26042

South Asian (SAS) AF: 0.00 AC: 0 AN: 59218

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 32120

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3382

European-Non Finnish (NFE) AF: 0.00000219 AC: 2 AN: 912384

Other (OTH) AF: 0.00 AC: 0 AN: 48030

GnomAD4 genome Cov.: 32

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs193922927; hg19: chr12-112036782;