chr12-111598978-TTGCTGCTGCTGCTGCTGCTGCTGCTGC-T

Variant names:

• chr12-111598978-TTGCTGCTGCTGCTGCTGCTGCTGCTGC-T
• NM_001372574.1:c.30_56delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001372574.1(ATXN2):​c.30_56delGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln11_Gln19del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000519 in 1,155,346 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000052 (0 hom.)
• Consequence: ATXN2 NM_001372574.1 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.93

Genes affected

ATXN2 (HGNC:10555): (ataxin 2) This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001372574.1
• BS2: High AC in GnomAdExome4 at 6 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATXN2	NM_001372574.1	c.30_56delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln11_Gln19del	disruptive_inframe_deletion	Exon 1 of 25	ENST00000673436.1	NP_001359503.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATXN2	ENST00000673436.1	c.30_56delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln11_Gln19del	disruptive_inframe_deletion	Exon 1 of 25		NM_001372574.1	ENSP00000500925.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000519 AC: 6 AN: 1155346 Hom.: 0 AF XY: 0.00000352 AC XY: 2 AN XY: 568206

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000658

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr12-112036782;