chr12-47975960-TACAGCAGGGCCGGTTTCGCCTGATCGTCCACGGGGACCAGGAGGCCCAATGGGGCCAGGGATTCCATTAGCACCATCTTTGCCAGAGGGACCGACGGGGCCAGGAGGACCCTGCAAGAGAGAGAGGTCGTGAGGAAAGAGTGGTCACCACAGGGAAGGCTGGGGAGTCGCTGGGGCTGGGTAGGTGGCTGTCCTGATAGCACCAGCCACTCCGCCCCCAGTTCTTCACATGCTCAGTCATGGAACCCTAAGTTGGTCTCTATTTGGCCAAGAACCAGCAGGATAGCTCCATGGCTTGCCTACCCTCCTAAGCTCCTCTTTGTAAAATGCTGTTCTGTCTGACAGCGAGAGGCTGATTCATGTTTGTCTTACAGCCATTGTGGCCTCAGGCG-T

Variant names:

• chr12-47975960-TACAGCAGGGCCGGTTTCGCCTGATCGTCCACGGGGACCAGGAGGCCCAATGGGGCCAGGGATTCCATTAGCACCATCTTTGCCAGAGGGACCGACGGGGCCAGGAGGACCCTGCAAGAGAGAGAGGTCGTGAGGAAAGAGTGGTCACCACAGGGAAGGCTGGGGAGTCGCTGGGGCTGGGTAGGTGGCTGTCCTGATAGCACCAGCCACTCCGCCCCCAGTTCTTCACATGCTCAGTCATGGAACCCTAAGTTGGTCTCTATTTGGCCAAGAACCAGCAGGATAGCTCCATGGCTTGCCTACCCTCCTAAGCTCCTCTTTGTAAAATGCTGTTCTGTCTGACAGCGAGAGGCTGATTCATGTTTGTCTTACAGCCATTGTGGCCTCAGGCG-T
• rs1555164872
• NM_001844.5:c.3489+163_3597+2del

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PVS1_Moderate PP5

The NM_001844.5(COL2A1):​c.3489+163_3597+2del variant causes a exon loss, splice acceptor, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: COL2A1 NM_001844.5 exon_loss, splice_acceptor, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.32
• Publications: 0 publications found

Genes affected

COL2A1 (HGNC:2200): (collagen type II alpha 1 chain) This gene encodes the alpha-1 chain of type II collagen, a fibrillar collagen found in cartilage and the vitreous humor of the eye. Mutations in this gene are associated with achondrogenesis, chondrodysplasia, early onset familial osteoarthritis, SED congenita, Langer-Saldino achondrogenesis, Kniest dysplasia, Stickler syndrome type I, and spondyloepimetaphyseal dysplasia Strudwick type. In addition, defects in processing chondrocalcin, a calcium binding protein that is the C-propeptide of this collagen molecule, are also associated with chondrodysplasia. There are two transcripts identified for this gene. [provided by RefSeq, Jul 2008]

COL2A1 Gene-Disease associations (from GenCC):

• achondrogenesis type II

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, G2P, Orphanet, Labcorp Genetics (formerly Invitae)
• Kniest dysplasia

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, ClinGen, Labcorp Genetics (formerly Invitae)
• platyspondylic dysplasia, Torrance type

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• spondyloepimetaphyseal dysplasia, Strudwick type

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• spondyloepiphyseal dysplasia congenita

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, G2P, Orphanet, Labcorp Genetics (formerly Invitae)
• spondyloepiphyseal dysplasia with metatarsal shortening

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: ClinGen, Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• spondylometaphyseal dysplasia

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• spondyloperipheral dysplasia

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• Stickler syndrome type 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, ClinGen, Illumina, Orphanet, Genomics England PanelApp
• Stickler syndrome, type I, nonsyndromic ocular

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• avascular necrosis of femoral head, primary, 1

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• Legg-Calve-Perthes disease

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
• mild spondyloepiphyseal dysplasia due to COL2A1 mutation with early-onset osteoarthritis

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet
• otospondylomegaepiphyseal dysplasia, autosomal recessive

  Inheritance: AD, AR Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
• spondyloepiphyseal dysplasia, Stanescu type

  Inheritance: AD Classification: MODERATE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• autosomal dominant rhegmatogenous retinal detachment

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• dysspondyloenchondromatosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• familial avascular necrosis of femoral head

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• hypochondrogenesis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• multiple epiphyseal dysplasia, Beighton type

  Inheritance: AD Classification: SUPPORTIVE, LIMITED Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
• spondylometaphyseal dysplasia, Schmidt type

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• otospondylomegaepiphyseal dysplasia

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics
• vitreoretinopathy with phalangeal epiphyseal dysplasia

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.024193548 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PP5: Variant 12-47975960-TACAGCAGGGCCGGTTTCGCCTGATCGTCCACGGGGACCAGGAGGCCCAATGGGGCCAGGGATTCCATTAGCACCATCTTTGCCAGAGGGACCGACGGGGCCAGGAGGACCCTGCAAGAGAGAGAGGTCGTGAGGAAAGAGTGGTCACCACAGGGAAGGCTGGGGAGTCGCTGGGGCTGGGTAGGTGGCTGTCCTGATAGCACCAGCCACTCCGCCCCCAGTTCTTCACATGCTCAGTCATGGAACCCTAAGTTGGTCTCTATTTGGCCAAGAACCAGCAGGATAGCTCCATGGCTTGCCTACCCTCCTAAGCTCCTCTTTGTAAAATGCTGTTCTGTCTGACAGCGAGAGGCTGATTCATGTTTGTCTTACAGCCATTGTGGCCTCAGGCG-T is Pathogenic according to our data. Variant chr12-47975960-TACAGCAGGGCCGGTTTCGCCTGATCGTCCACGGGGACCAGGAGGCCCAATGGGGCCAGGGATTCCATTAGCACCATCTTTGCCAGAGGGACCGACGGGGCCAGGAGGACCCTGCAAGAGAGAGAGGTCGTGAGGAAAGAGTGGTCACCACAGGGAAGGCTGGGGAGTCGCTGGGGCTGGGTAGGTGGCTGTCCTGATAGCACCAGCCACTCCGCCCCCAGTTCTTCACATGCTCAGTCATGGAACCCTAAGTTGGTCTCTATTTGGCCAAGAACCAGCAGGATAGCTCCATGGCTTGCCTACCCTCCTAAGCTCCTCTTTGTAAAATGCTGTTCTGTCTGACAGCGAGAGGCTGATTCATGTTTGTCTTACAGCCATTGTGGCCTCAGGCG-T is described in ClinVar as Pathogenic. ClinVar VariationId is 17351.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001844.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL2A1	NM_001844.5	MANE Select	c.3489+163_3597+2del		exon_loss splice_acceptor splice_donor splice_region intron	Exon 50 of 54	NP_001835.3
	COL2A1	NM_033150.3		c.3282+163_3390+2del		exon_loss splice_acceptor splice_donor splice_region intron	Exon 49 of 53	NP_149162.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL2A1	ENST00000380518.8	TSL:1 MANE Select	c.3489+163_3597+2del		exon_loss splice_acceptor splice_donor splice_region intron	Exon 50 of 54	ENSP00000369889.3
	COL2A1	ENST00000337299.7	TSL:1	c.3282+163_3390+2del		exon_loss splice_acceptor splice_donor splice_region intron	Exon 49 of 53	ENSP00000338213.6
	COL2A1	ENST00000546974.1	TSL:1	n.342+163_450+2del		splice_acceptor splice_donor splice_region intron non_coding_transcript_exon	Exon 5 of 6

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Spondyloepiphyseal dysplasia congenita (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555164872; hg19: chr12-48369743;