chr13-36819406-GGCGTGCCCCACCCCGCGGCCCTAGCCCCGGCTGCGGCTCCCACCTTGGC-G

Variant names:

• chr13-36819406-GGCGTGCCCCACCCCGCGGCCCTAGCCCCGGCTGCGGCTCCCACCTTGGC-G
• rs2057953516
• NM_000538.4:c.52_100delGTGCCCCACCCCGCGGCCCTAGCCCCGGCTGCGGCTCCCACCTTGGCGC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000538.4(RFXAP):​c.52_100delGTGCCCCACCCCGCGGCCCTAGCCCCGGCTGCGGCTCCCACCTTGGCGC​(p.Val18GlnfsTer14) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000152 in 1,313,710 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. V18V) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 8.6e-7 (0 hom.)
• Consequence: RFXAP NM_000538.4 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.77
• Publications: 0 publications found

Genes affected

RFXAP (HGNC:9988): (regulatory factor X associated protein) Major histocompatibility (MHC) class II molecules are transmembrane proteins that have a central role in development and control of the immune system. The protein encoded by this gene, along with regulatory factor X-associated ankyrin-containing protein and regulatory factor-5, forms a complex that binds to the X box motif of certain MHC class II gene promoters and activates their transcription. Once bound to the promoter, this complex associates with the non-DNA-binding factor MHC class II transactivator, which controls the cell type specificity and inducibility of MHC class II gene expression. Mutations in this gene have been linked to bare lymphocyte syndrome type II, complementation group D. Transcript variants utilizing different polyA signals have been found for this gene. [provided by RefSeq, Jul 2008]

RFXAP Gene-Disease associations (from GenCC):

• MHC class II deficiency

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Orphanet

ENSG00000309469 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 21 pathogenic variants in the truncated region.
• PP5: Variant 13-36819406-GGCGTGCCCCACCCCGCGGCCCTAGCCCCGGCTGCGGCTCCCACCTTGGC-G is Pathogenic according to our data. Variant chr13-36819406-GGCGTGCCCCACCCCGCGGCCCTAGCCCCGGCTGCGGCTCCCACCTTGGC-G is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 3575882.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000538.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RFXAP	NM_000538.4	MANE Select	c.52_100delGTGCCCCACCCCGCGGCCCTAGCCCCGGCTGCGGCTCCCACCTTGGCGC	p.Val18GlnfsTer14	frameshift	Exon 1 of 3	NP_000529.1	O00287

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RFXAP	ENST00000255476.3	TSL:1 MANE Select	c.52_100delGTGCCCCACCCCGCGGCCCTAGCCCCGGCTGCGGCTCCCACCTTGGCGC	p.Val18GlnfsTer14	frameshift	Exon 1 of 3	ENSP00000255476.3	O00287
	ENSG00000309469	ENST00000841309.1		n.122+122_122+170delGCCAAGGTGGGAGCCGCAGCCGGGGCTAGGGCCGCGGGGTGGGGCACGC		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.00000659 AC: 1 AN: 151856 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 8.61e-7 AC: 1 AN: 1161854 Hom.: 0 AF XY: 0.00000179 AC XY: 1 AN XY: 558148

African (AFR) AF: 0.00 AC: 0 AN: 23366

American (AMR) AF: 0.00 AC: 0 AN: 8954

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 15396

East Asian (EAS) AF: 0.00 AC: 0 AN: 27310

South Asian (SAS) AF: 0.00 AC: 0 AN: 32470

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 33676

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3500

European-Non Finnish (NFE) AF: 0.00000103 AC: 1 AN: 969758

Other (OTH) AF: 0.00 AC: 0 AN: 47424

GnomAD4 genome AF: 0.00000659 AC: 1 AN: 151856 Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1 AN XY: 74176

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 41390

American (AMR) AF: 0.00 AC: 0 AN: 15262

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3468

East Asian (EAS) AF: 0.00 AC: 0 AN: 5128

South Asian (SAS) AF: 0.00 AC: 0 AN: 4834

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10566

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 67892

Other (OTH) AF: 0.00 AC: 0 AN: 2090

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	MHC class II deficiency 4 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.8
Mutation Taster		=45/155	disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs2057953516; hg19: chr13-37393543;