chr13-36819406-GGCGTGCCCCACCCCGCGGCCCTAGCCCCGGCTGCGGCTCCCACCTTGGC-G
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000538.4(RFXAP):c.52_100delGTGCCCCACCCCGCGGCCCTAGCCCCGGCTGCGGCTCCCACCTTGGCGC(p.Val18GlnfsTer14) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000152 in 1,313,710 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. V18V) has been classified as Likely benign.
Frequency
Consequence
NM_000538.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- MHC class II deficiencyInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000538.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RFXAP | TSL:1 MANE Select | c.52_100delGTGCCCCACCCCGCGGCCCTAGCCCCGGCTGCGGCTCCCACCTTGGCGC | p.Val18GlnfsTer14 | frameshift | Exon 1 of 3 | ENSP00000255476.3 | O00287 | ||
| ENSG00000309469 | n.122+122_122+170delGCCAAGGTGGGAGCCGCAGCCGGGGCTAGGGCCGCGGGGTGGGGCACGC | intron | N/A |
Frequencies
GnomAD3 genomes AF: 0.00000659 AC: 1AN: 151856Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome AF: 8.61e-7 AC: 1AN: 1161854Hom.: 0 AF XY: 0.00000179 AC XY: 1AN XY: 558148 show subpopulations
GnomAD4 genome AF: 0.00000659 AC: 1AN: 151856Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1AN XY: 74176 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at