chr13-52455635-CGCGGTGGCGGTGGCGGTGGCGGTGGCGGTG-C
Variant summary
Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2
The NM_018204.5(CKAP2):c.70+20_70+49delTGGCGGTGGCGGTGGCGGTGGCGGTGGCGG variant causes a intron change. The variant allele was found at a frequency of 0.000947 in 1,563,148 control chromosomes in the GnomAD database, including 5 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_018204.5 intron
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_018204.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CKAP2 | MANE Select | c.70+20_70+49delTGGCGGTGGCGGTGGCGGTGGCGGTGGCGG | intron | N/A | NP_060674.3 | ||||
| CKAP2 | c.70+20_70+49delTGGCGGTGGCGGTGGCGGTGGCGGTGGCGG | intron | N/A | NP_001091995.1 | Q8WWK9-1 | ||||
| CKAP2 | c.70+20_70+49delTGGCGGTGGCGGTGGCGGTGGCGGTGGCGG | intron | N/A | NP_001273616.1 | Q8WWK9-4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CKAP2 | TSL:1 MANE Select | c.70+10_70+39delGCGGTGGCGGTGGCGGTGGCGGTGGCGGTG | intron | N/A | ENSP00000258607.5 | Q8WWK9-5 | |||
| CKAP2 | TSL:1 | c.70+10_70+39delGCGGTGGCGGTGGCGGTGGCGGTGGCGGTG | intron | N/A | ENSP00000367276.4 | Q8WWK9-1 | |||
| CKAP2 | TSL:1 | c.70+10_70+39delGCGGTGGCGGTGGCGGTGGCGGTGGCGGTG | intron | N/A | ENSP00000367273.2 | Q8WWK9-4 |
Frequencies
GnomAD3 genomes AF: 0.000837 AC: 127AN: 151712Hom.: 1 Cov.: 0 show subpopulations
GnomAD2 exomes AF: 0.000897 AC: 167AN: 186206 AF XY: 0.000873 show subpopulations
GnomAD4 exome AF: 0.000959 AC: 1353AN: 1411328Hom.: 4 AF XY: 0.000973 AC XY: 683AN XY: 701972 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000837 AC: 127AN: 151820Hom.: 1 Cov.: 0 AF XY: 0.000782 AC XY: 58AN XY: 74200 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.