chr13-99984951-AAGCCGTTCCAGTGTGAGTTTGAGGGCTGCGACCGGCGCTTCGCCAAC-A

Variant names:

• chr13-99984951-AAGCCGTTCCAGTGTGAGTTTGAGGGCTGCGACCGGCGCTTCGCCAAC-A
• rs1555332362
• NM_007129.5:c.1085_1131delCGTTCCAGTGTGAGTTTGAGGGCTGCGACCGGCGCTTCGCCAACAGC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_007129.5(ZIC2):​c.1085_1131delCGTTCCAGTGTGAGTTTGAGGGCTGCGACCGGCGCTTCGCCAACAGC​(p.Pro362GlnfsTer14) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. P362P) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ZIC2 NM_007129.5 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.26
• Publications: 0 publications found

Genes affected

ZIC2 (HGNC:12873): (Zic family member 2) This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]

ZIC2 Gene-Disease associations (from GenCC):

• holoprosencephaly 5

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp
• holoprosencephaly

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 13-99984951-AAGCCGTTCCAGTGTGAGTTTGAGGGCTGCGACCGGCGCTTCGCCAAC-A is Pathogenic according to our data. Variant chr13-99984951-AAGCCGTTCCAGTGTGAGTTTGAGGGCTGCGACCGGCGCTTCGCCAAC-A is described in ClinVar as Pathogenic. ClinVar VariationId is 437335.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ZIC2	NM_007129.5	c.1085_1131delCGTTCCAGTGTGAGTTTGAGGGCTGCGACCGGCGCTTCGCCAACAGC	p.Pro362GlnfsTer14	frameshift_variant	Exon 2 of 3	ENST00000376335.8	NP_009060.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ZIC2	ENST00000376335.8	c.1085_1131delCGTTCCAGTGTGAGTTTGAGGGCTGCGACCGGCGCTTCGCCAACAGC	p.Pro362GlnfsTer14	frameshift_variant	Exon 2 of 3	1	NM_007129.5	ENSP00000365514.3
ZIC2	ENST00000468291.1	n.59_105delCGTTCCAGTGTGAGTTTGAGGGCTGCGACCGGCGCTTCGCCAACAGC		non_coding_transcript_exon_variant	Exon 2 of 3	2
ZIC2	ENST00000477213.1	n.167_213delCGTTCCAGTGTGAGTTTGAGGGCTGCGACCGGCGCTTCGCCAACAGC		non_coding_transcript_exon_variant	Exon 1 of 2	2
ZIC2	ENST00000490085.5	n.131_177delCGTTCCAGTGTGAGTTTGAGGGCTGCGACCGGCGCTTCGCCAACAGC		non_coding_transcript_exon_variant	Exon 2 of 3	3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Holoprosencephaly 5 Pathogenic:1

Jul 08, 2016

Genetic Services Laboratory, University of Chicago

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3
Mutation Taster		=3/197	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555332362; hg19: chr13-100637205;