chr14-88607345-ACCCCATCTCACCCTGCAAGTGAGTACCATCC-A

Position:

• chr14-88607345-ACCCCATCTCACCCTGCAAGTGAGTACCATCC-A

Variant summary

Our verdict is Likely benign. Variant got -3 ACMG points: 1P and 4B. PP3 BS2

The NM_024824.5(ZC3H14):​c.1868+34_1868+64delGAGTACCATCCCCCCATCTCACCCTGCAAGT variant causes a intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000195 in 1,460,054 control chromosomes in the GnomAD database, including 2 homozygotes. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.0013 (1 hom., cov: 31)
  • Exomes 𝑓: 0.00020 (2 hom.)
  • Failed GnomAD Quality Control
• Consequence: ZC3H14 NM_024824.5 intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 7.57

Genes affected

ZC3H14 (HGNC:20509): (zinc finger CCCH-type containing 14) The protein encoded by this gene is a poly(A)-binding protein that can affect gene expression and poly(A) tail length. The encoded protein may influence mRNA stability, nuclear export, and translation. [provided by RefSeq, May 2016]

ZC3H14 (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -3 ACMG points.

• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• BS2: High Homozygotes in GnomAdExome4 at 2 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ZC3H14	NM_024824.5	c.1868+34_1868+64delGAGTACCATCCCCCCATCTCACCCTGCAAGT		intron_variant		ENST00000251038.10	NP_079100.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ZC3H14	ENST00000251038.10	c.1868+34_1868+64delGAGTACCATCCCCCCATCTCACCCTGCAAGT		intron_variant		1	NM_024824.5	ENSP00000251038.5

Frequencies

GnomAD3 genomes AF: 0.00 AC: 196 AN: 150206 Hom.: 1 Cov.: 31 FAILED QC

Gnomad AFR AF: 0.00389

Gnomad AMI AF: 0.0158

Gnomad AMR AF: 0.000331

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000390

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.0000957

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000237

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.000430 AC: 108 AN: 251192 Hom.: 0 AF XY: 0.000309 AC XY: 42 AN XY: 135748

Gnomad AFR exome AF: 0.00523

Gnomad AMR exome AF: 0.000289

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000435

Gnomad SAS exome AF: 0.0000327

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000264

Gnomad OTH exome AF: 0.000163

GnomAD4 exome AF: 0.000195 AC: 285 AN: 1460054 Hom.: 2 AF XY: 0.000191 AC XY: 139 AN XY: 726310

Gnomad4 AFR exome AF: 0.00610

Gnomad4 AMR exome AF: 0.000269

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000177

Gnomad4 SAS exome AF: 0.0000348

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000333

Gnomad4 OTH exome AF: 0.000348

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.00130 AC: 195 AN: 150322 Hom.: 1 Cov.: 31 AF XY: 0.00118 AC XY: 87 AN XY: 73456

Gnomad4 AFR AF: 0.00388

Gnomad4 AMR AF: 0.000265

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000391

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.0000957

Gnomad4 NFE AF: 0.000237

Gnomad4 OTH AF: 0.00

Alfa AF: 0.000153 Hom.: 0

Asia WGS AF: 0.00231 AC: 8 AN: 3478

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Genetic Services Laboratory, University of Chicago

Feb 18, 2016

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs746759188; hg19: chr14-89073689;