chr15-40768002-C-CCGCCTGGCGCATGCGCATCATGACGAGGCT

Position:

• chr15-40768002-C-CCGCCTGGCGCATGCGCATCATGACGAGGCT

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_018163.3(DNAJC17):​c.823_852dupAGCCTCGTCATGATGCGCATGCGCCAGGCG​(p.Ala284_Ala285insSerLeuValMetMetArgMetArgGlnAla) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: DNAJC17 NM_018163.3 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -3.20

Genes affected

DNAJC17 (HGNC:25556): (DnaJ heat shock protein family (Hsp40) member C17) Predicted to enable RNA binding activity. Predicted to act upstream of or within negative regulation of transcription by RNA polymerase II and toxin transport. Predicted to be located in cytoplasm and nucleus. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_018163.3.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
DNAJC17	NM_018163.3	c.823_852dupAGCCTCGTCATGATGCGCATGCGCCAGGCG	p.Ala284_Ala285insSerLeuValMetMetArgMetArgGlnAla	conservative_inframe_insertion	11/11	ENST00000220496.9	NP_060633.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
DNAJC17	ENST00000220496.9	c.823_852dupAGCCTCGTCATGATGCGCATGCGCCAGGCG	p.Ala284_Ala285insSerLeuValMetMetArgMetArgGlnAla	conservative_inframe_insertion	11/11	1	NM_018163.3	ENSP00000220496.4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 33

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Sep 28, 2022

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant has not been reported in the literature in individuals affected with DNAJC17-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.823_852dup, results in the insertion of 10 amino acid(s) of the DNAJC17 protein (p.Ser275_Ala284dup), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr15-41060200;