chr15-80153034-CCGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGG-C
Variant summary
Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1PS1_ModeratePP5_Moderate
The NM_000137.4(FAH):c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC(p.Met1_Ala7del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Consequence
NM_000137.4 start_lost, conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- tyrosinemia type IInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Myriad Women’s Health, G2P, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, Laboratory for Molecular Medicine
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 12 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000137.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FAH | MANE Select | c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC | p.Met1_Ala7del | start_lost conservative_inframe_deletion | Exon 1 of 14 | NP_000128.1 | A0A384P5L6 | ||
| FAH | MANE Select | c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC | 5_prime_UTR | Exon 1 of 14 | NP_000128.1 | A0A384P5L6 | |||
| FAH | c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC | p.Met1_Ala7del | start_lost conservative_inframe_deletion | Exon 2 of 15 | NP_001361306.1 | A0A384P5L6 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FAH | TSL:1 MANE Select | c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC | p.Met1_Ala7del | start_lost conservative_inframe_deletion | Exon 1 of 14 | ENSP00000453347.2 | P16930-1 | ||
| FAH | TSL:1 MANE Select | c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC | 5_prime_UTR | Exon 1 of 14 | ENSP00000453347.2 | P16930-1 | |||
| FAH | c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC | p.Met1_Ala7del | start_lost conservative_inframe_deletion | Exon 2 of 16 | ENSP00000544716.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at