chr15-80153034-CCGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGG-C

Variant names:

• chr15-80153034-CCGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGG-C
• NM_000137.4:c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1 PS1_Moderate PP5_Moderate

The NM_000137.4(FAH):​c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC​(p.Met1_Ala7del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: FAH NM_000137.4 start_lost, conservative_inframe_deletion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.944
• Publications: 0 publications found

Genes affected

FAH (HGNC:3579): (fumarylacetoacetate hydrolase) Predicted to enable fumarylacetoacetase activity. Predicted to be involved in L-phenylalanine catabolic process; homogentisate catabolic process; and tyrosine catabolic process. Predicted to act upstream of or within arginine catabolic process. Located in extracellular exosome. Implicated in tyrosinemia type I. [provided by Alliance of Genome Resources, Apr 2022]

FAH Gene-Disease associations (from GenCC):

• tyrosinemia type I

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Myriad Women’s Health, G2P, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, Laboratory for Molecular Medicine

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PVS1: Start lost variant, no new inframe start found.
• PS1: Another start lost variant in NM_000137.4 (FAH) was described as [Pathogenic] in ClinVar
• PP5: Variant 15-80153034-CCGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGG-C is Pathogenic according to our data. Variant chr15-80153034-CCGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGG-C is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 3577779.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000137.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FAH	NM_000137.4	MANE Select	c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC	p.Met1_Ala7del	start_lost conservative_inframe_deletion	Exon 1 of 14	NP_000128.1	A0A384P5L6
	FAH	NM_000137.4	MANE Select	c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC		5_prime_UTR	Exon 1 of 14	NP_000128.1	A0A384P5L6
	FAH	NM_001374377.1		c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC	p.Met1_Ala7del	start_lost conservative_inframe_deletion	Exon 2 of 15	NP_001361306.1	A0A384P5L6

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FAH	ENST00000561421.6	TSL:1 MANE Select	c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC	p.Met1_Ala7del	start_lost conservative_inframe_deletion	Exon 1 of 14	ENSP00000453347.2	P16930-1
	FAH	ENST00000561421.6	TSL:1 MANE Select	c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC		5_prime_UTR	Exon 1 of 14	ENSP00000453347.2	P16930-1
	FAH	ENST00000874657.1		c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC	p.Met1_Ala7del	start_lost conservative_inframe_deletion	Exon 2 of 16	ENSP00000544716.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Tyrosinemia type I (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.94

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr15-80445376;