chr15-89333596-TTGCTGCTGCTGCTGCTGCTGC-T

Variant names:

• chr15-89333596-TTGCTGCTGCTGCTGCTGCTGC-T
• rs41550117
• ENST00000706918.1:c.193_213delGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM2 BP3 BP6

The NM_001430120.1(POLGARF):​c.193_213delGCAGCAGCAGCAGCAGCAGCA​(p.Ala65_Ala71del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000476 in 1,598,000 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.000086 (0 hom., cov: 30)
  • Exomes 𝑓: 0.000044 (0 hom.)
• Consequence: POLGARF NM_001430120.1 conservative_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2 B:1
• Conservation: PhyloP100: 0.0750

Genes affected

POLGARF (HGNC:56246): (POLG alternative reading frame) This gene uses the same transcript as the POLG gene but has a CUG start codon and an alternate reading frame that makes a 260 aa protein. This protein is distinct from POLG isoforms and may interact with P32 (also known as C1QBP), a mitochondrial matrix protein thought to be involved in the expression of mitochondrial genome-encoded proteins. POLGARF protein may bind P32 and sequester it in the nucleolus. Interestingly, some disease-causing mutations thought to be in POLG may instead be associated with POLGARF. [provided by RefSeq, May 2022]

POLG (HGNC:9179): (DNA polymerase gamma, catalytic subunit) Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP3: Nonframeshift variant in repetitive region in NM_001430120.1
• BP6: Variant 15-89333596-TTGCTGCTGCTGCTGCTGCTGC-T is Benign according to our data. Variant chr15-89333596-TTGCTGCTGCTGCTGCTGCTGC-T is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 289240.We mark this variant Likely_benign, oryginal submissions are: {Likely_benign=1, Uncertain_significance=2}. Variant chr15-89333596-TTGCTGCTGCTGCTGCTGCTGC-T is described in Lovd as [Likely_benign].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
POLG	NM_002693.3	c.138_158delGCAGCAGCAGCAGCAGCAGCA	p.Gln47_Gln53del	disruptive_inframe_deletion	Exon 2 of 23	ENST00000268124.11	NP_002684.1
POLGARF	NM_001430120.1	c.193_213delGCAGCAGCAGCAGCAGCAGCA	p.Ala65_Ala71del	conservative_inframe_deletion	Exon 1 of 2		NP_001417049.1
POLG	NM_001126131.2	c.138_158delGCAGCAGCAGCAGCAGCAGCA	p.Gln47_Gln53del	disruptive_inframe_deletion	Exon 2 of 23		NP_001119603.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
POLGARF	ENST00000706918.1	c.193_213delGCAGCAGCAGCAGCAGCAGCA	p.Ala65_Ala71del	conservative_inframe_deletion	Exon 1 of 2			ENSP00000516626.1
POLG	ENST00000268124.11	c.138_158delGCAGCAGCAGCAGCAGCAGCA	p.Gln47_Gln53del	disruptive_inframe_deletion	Exon 2 of 23	1	NM_002693.3	ENSP00000268124.5

Frequencies

GnomAD3 genomes AF: 0.0000857 AC: 13 AN: 151604 Hom.: 0 Cov.: 30

Gnomad AFR AF: 0.0000243

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000131

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000193

Gnomad SAS AF: 0.000208

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000118

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000436 AC: 63 AN: 1446396 Hom.: 0 AF XY: 0.0000473 AC XY: 34 AN XY: 719198

Gnomad4 AFR exome AF: 0.0000609

Gnomad4 AMR exome AF: 0.000114

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000507

Gnomad4 SAS exome AF: 0.0000821

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000389

Gnomad4 OTH exome AF: 0.0000670

GnomAD4 genome AF: 0.0000857 AC: 13 AN: 151604 Hom.: 0 Cov.: 30 AF XY: 0.0000540 AC XY: 4 AN XY: 74046

Gnomad4 AFR AF: 0.0000243

Gnomad4 AMR AF: 0.000131

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000193

Gnomad4 SAS AF: 0.000208

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000118

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:2 Benign:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Uncertain:1

Jul 21, 2022

Mayo Clinic Laboratories, Mayo Clinic

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

PM2 -

Progressive sclerosing poliodystrophy Uncertain:1

Dec 24, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.138_158del, results in the deletion of 7 amino acid(s) of the POLG protein (p.Gln49_Gln55del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with POLG-related conditions. ClinVar contains an entry for this variant (Variation ID: 289240). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

not specified Benign:1

Jul 01, 2016

Eurofins Ntd Llc (ga)

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs41550117; hg19: chr15-89876827;