chr15-89776915-GGGGCAGGGGCAAGGGCAGGGGCAA-G

Variant names:

• chr15-89776915-GGGGCAGGGGCAAGGGCAGGGGCAA-G
• rs776243191
• NM_001039958.2:c.561_584delGCAGGGGCAAGGGCAGGGGCAAGG

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The NM_001039958.2(MESP2):​c.561_584delGCAGGGGCAAGGGCAGGGGCAAGG​(p.Gln188_Gly195del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★). Synonymous variant affecting the same amino acid position (i.e. G187G) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 0)
• Consequence: MESP2 NM_001039958.2 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.59
• Publications: 0 publications found

Genes affected

MESP2 (HGNC:29659): (mesoderm posterior bHLH transcription factor 2) This gene encodes a member of the bHLH family of transcription factors and plays a key role in defining the rostrocaudal patterning of somites via interactions with multiple Notch signaling pathways. This gene is expressed in the anterior presomitic mesoderm and is downregulated immediately after the formation of segmented somites. This gene also plays a role in the formation of epithelial somitic mesoderm and cardiac mesoderm. Mutations in the MESP2 gene cause autosomal recessive spondylocostal dystosis 2 (SCD02). [provided by RefSeq, Oct 2008]

MESP2 Gene-Disease associations (from GenCC):

• spondylocostal dysostosis 2, autosomal recessive

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• autosomal recessive spondylocostal dysostosis

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP6: Variant 15-89776915-GGGGCAGGGGCAAGGGCAGGGGCAA-G is Benign according to our data. Variant chr15-89776915-GGGGCAGGGGCAAGGGCAGGGGCAA-G is described in ClinVar as Benign. ClinVar VariationId is 257244.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001039958.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MESP2	NM_001039958.2	MANE Select	c.561_584delGCAGGGGCAAGGGCAGGGGCAAGG	p.Gln188_Gly195del	disruptive_inframe_deletion	Exon 1 of 2	NP_001035047.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MESP2	ENST00000341735.5	TSL:1 MANE Select	c.561_584delGCAGGGGCAAGGGCAGGGGCAAGG	p.Gln188_Gly195del	disruptive_inframe_deletion	Exon 1 of 2	ENSP00000342392.3
	MESP2	ENST00000560219.2	TSL:1	c.31-1147_31-1124delGCAGGGGCAAGGGCAGGGGCAAGG		intron	N/A	ENSP00000452998.1
	MESP2	ENST00000558723.1	TSL:3	n.39-1147_39-1124delGCAGGGGCAAGGGCAGGGGCAAGG		intron	N/A

Frequencies

GnomAD3 genomes Cov.: 0

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 0

ClinVar

ClinVar submissions as Germline

Significance: Benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.6
Mutation Taster		=182/18	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs776243191; hg19: chr15-90320146;