chr16-2093032-GAGGCATCCCCATAGCTGGCC-G

Variant names:

• chr16-2093032-GAGGCATCCCCATAGCTGGCC-G
• rs1555446611
• NM_001009944.3:c.11058_11077delGGCCAGCTATGGGGATGCCT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001009944.3(PKD1):​c.11058_11077delGGCCAGCTATGGGGATGCCT​(p.Ala3687MetfsTer28) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: PKD1 NM_001009944.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 6.42
• Publications: 0 publications found

Genes affected

PKD1 (HGNC:9008): (polycystin 1, transient receptor potential channel interacting) This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]

PKD1-AS1 (HGNC:56035): (PKD1 antisense RNA 1)

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 16-2093032-GAGGCATCCCCATAGCTGGCC-G is Pathogenic according to our data. Variant chr16-2093032-GAGGCATCCCCATAGCTGGCC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 447947.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001009944.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PKD1	NM_001009944.3	MANE Select	c.11058_11077delGGCCAGCTATGGGGATGCCT	p.Ala3687MetfsTer28	frameshift	Exon 38 of 46	NP_001009944.3
	PKD1	NM_000296.4		c.11055_11074delGGCCAGCTATGGGGATGCCT	p.Ala3686MetfsTer28	frameshift	Exon 38 of 46	NP_000287.4
	PKD1-AS1	NR_135175.1		n.303+23_303+42delGCATCCCCATAGCTGGCCAG		intron	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PKD1	ENST00000262304.9	TSL:1 MANE Select	c.11058_11077delGGCCAGCTATGGGGATGCCT	p.Ala3687MetfsTer28	frameshift	Exon 38 of 46	ENSP00000262304.4
	PKD1	ENST00000423118.5	TSL:1	c.11055_11074delGGCCAGCTATGGGGATGCCT	p.Ala3686MetfsTer28	frameshift	Exon 38 of 46	ENSP00000399501.1
	PKD1	ENST00000472659.1	TSL:3	n.495_514delGGCCAGCTATGGGGATGCCT		non_coding_transcript_exon	Exon 4 of 4

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.4
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555446611; hg19: chr16-2143033;