chr16-87604287-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-C

Variant names:

• chr16-87604287-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-C
• NM_020655.4:c.382+772_382+801delCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Variant summary

Our verdict is Likely benign. Variant got -3 ACMG points: 2P and 5B. PM2 BP3 BS2

The NM_001271604.4(JPH3):​c.443_472delCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG​(p.Ala148_Ala157del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000039 in 1,282,846 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 0)
  • Exomes 𝑓: 0.0000039 (0 hom.)
• Consequence: JPH3 NM_001271604.4 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.966

Genes affected

JPH3 (HGNC:14203): (junctophilin 3) Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. CAG/CTG repeat expansion from normally 6-28 repeats to 40-59 repeats in the 3' UTR of this gene have been associated with Huntington disease-like 2 (HDL2). This gene is a member of the junctophilin gene family. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Likely_benign. Variant got -3 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP3: Nonframeshift variant in repetitive region in NM_001271604.4
• BS2: High AC in GnomAdExome4 at 5 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
JPH3	NM_020655.4	c.382+772_382+801delCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron_variant	Intron 1 of 4	ENST00000284262.3	NP_065706.2
JPH3	NM_001271604.4	c.443_472delCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	p.Ala148_Ala157del	disruptive_inframe_deletion	Exon 2 of 2		NP_001258533.1
JPH3	NM_001271605.3	c.*141_*170delCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		3_prime_UTR_variant	Exon 2 of 2		NP_001258534.1
JPH3	NR_073379.3	n.96+2370_96+2399delCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron_variant	Intron 1 of 5

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
JPH3	ENST00000284262.3	c.382+772_382+801delCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron_variant	Intron 1 of 4	1	NM_020655.4	ENSP00000284262.2
JPH3	ENST00000301008.5	n.703_732delCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		non_coding_transcript_exon_variant	Exon 2 of 2	1
JPH3	ENST00000537256.5	n.96+2370_96+2399delCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron_variant	Intron 1 of 5	2

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome AF: 0.00000390 AC: 5 AN: 1282846 Hom.: 0 AF XY: 0.00000474 AC XY: 3 AN XY: 633004

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000494

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr16-87637893;