chr16-88706560-GCCGGCGCCTGAGGAGCCGCCC-G
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_001012759.3(CTU2):c.39_59delTGAGGAGCCGCCCCCGGCGCC(p.Glu14_Pro20del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000548 in 1,458,760 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001012759.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CTU2 | NM_001012759.3 | c.39_59delTGAGGAGCCGCCCCCGGCGCC | p.Glu14_Pro20del | disruptive_inframe_deletion | Exon 1 of 15 | ENST00000453996.7 | NP_001012777.1 | |
CTU2 | NM_001318507.2 | c.39_59delTGAGGAGCCGCCCCCGGCGCC | p.Glu14_Pro20del | disruptive_inframe_deletion | Exon 1 of 15 | NP_001305436.1 | ||
CTU2 | NM_001012762.3 | c.39_59delTGAGGAGCCGCCCCCGGCGCC | p.Glu14_Pro20del | disruptive_inframe_deletion | Exon 1 of 14 | NP_001012780.1 | ||
CTU2 | NM_001318513.2 | c.-144_-124delTGAGGAGCCGCCCCCGGCGCC | 5_prime_UTR_variant | Exon 1 of 14 | NP_001305442.1 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00000658 AC: 1AN: 152076Hom.: 0 Cov.: 33
GnomAD4 exome AF: 0.00000536 AC: 7AN: 1306684Hom.: 0 AF XY: 0.00000155 AC XY: 1AN XY: 644558
GnomAD4 genome AF: 0.00000658 AC: 1AN: 152076Hom.: 0 Cov.: 33 AF XY: 0.0000135 AC XY: 1AN XY: 74288
ClinVar
Submissions by phenotype
not provided Uncertain:1
Not observed at significant frequency in large population cohorts (gnomAD); In-frame deletion of 7 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; Has not been previously published as pathogenic or benign to our knowledge -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at