chr17-11598517-CGGGCCGCGCTCGCGGCGGAGAA-AACGCGGATGGGGAACCCGGCGCCGAC

Position:

• chr17-11598517-CGGGCCGCGCTCGCGGCGGAGAA-AACGCGGATGGGGAACCCGGCGCCGAC

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_001372.4(DNAH9):​c.19_41delCGGGCCGCGCTCGCGGCGGAGAAinsAACGCGGATGGGGAACCCGGCGCCGAC​(p.Arg7fs) variant causes a frameshift, missense change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: DNAH9 NM_001372.4 frameshift, missense
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.786

Genes affected

DNAH9 (HGNC:2953): (dynein axonemal heavy chain 9) This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 8 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-11598517-CGGGCCGCGCTCGCGGCGGAGAA-AACGCGGATGGGGAACCCGGCGCCGAC is Pathogenic according to our data. Variant chr17-11598517-CGGGCCGCGCTCGCGGCGGAGAA-AACGCGGATGGGGAACCCGGCGCCGAC is described in ClinVar as [Pathogenic]. Clinvar id is 1992905.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
DNAH9	NM_001372.4	c.19_41delCGGGCCGCGCTCGCGGCGGAGAAinsAACGCGGATGGGGAACCCGGCGCCGAC	p.Arg7fs	frameshift_variant, missense_variant	1/69	ENST00000262442.9	NP_001363.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
DNAH9	ENST00000262442.9	c.19_41delCGGGCCGCGCTCGCGGCGGAGAAinsAACGCGGATGGGGAACCCGGCGCCGAC	p.Arg7fs	frameshift_variant, missense_variant	1/69	1	NM_001372.4	ENSP00000262442.3
DNAH9	ENST00000579406.1	n.46_68delCGGGCCGCGCTCGCGGCGGAGAAinsAACGCGGATGGGGAACCCGGCGCCGAC		non_coding_transcript_exon_variant	1/8	1
DNAH9	ENST00000454412.6	c.19_41delCGGGCCGCGCTCGCGGCGGAGAAinsAACGCGGATGGGGAACCCGGCGCCGAC	p.Arg7fs	frameshift_variant, missense_variant	1/68	5		ENSP00000414874.2
DNAH9	ENST00000579828.5	c.19_41delCGGGCCGCGCTCGCGGCGGAGAAinsAACGCGGATGGGGAACCCGGCGCCGAC	p.Arg7fs	frameshift_variant, missense_variant	1/4	2		ENSP00000463782.1

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

May 19, 2022

For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with DNAH9-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Arg7Asnfs*46) in the DNAH9 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in DNAH9 are known to be pathogenic (PMID: 30471718). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr17-11501834;