chr17-1650774-GAGGCTGAAGCAGGAGGCAGGGAAACGGTCAGGC-G

Position:

• chr17-1650774-GAGGCTGAAGCAGGAGGCAGGGAAACGGTCAGGC-G

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_006445.4(PRPF8):​c.7003_*27delGCCTGACCGTTTCCCTGCCTCCTGCTTCAGCCT​(p.Ala2335_Ter2336del) variant causes a stop lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: PRPF8 NM_006445.4 stop_lost, conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.39

Genes affected

PRPF8 (HGNC:17340): (pre-mRNA processing factor 8) Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]

PRPF8 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Stoplost variant. No alternative stopcodon identified downstream, so we assume a Nonstop Mediated Decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PRPF8	NM_006445.4	c.7003_*27delGCCTGACCGTTTCCCTGCCTCCTGCTTCAGCCT	p.Ala2335_Ter2336del	stop_lost, conservative_inframe_deletion	43/43	ENST00000304992.11	NP_006436.3
PRPF8	NM_006445.4	c.7002_*27delGCCTGACCGTTTCCCTGCCTCCTGCTTCAGCCT		3_prime_UTR_variant	43/43	ENST00000304992.11	NP_006436.3
PRPF8	XM_024450537.2	c.7003_*27delGCCTGACCGTTTCCCTGCCTCCTGCTTCAGCCT	p.Ala2335_Ter2336del	stop_lost, conservative_inframe_deletion	43/43		XP_024306305.1
PRPF8	XM_024450537.2	c.7002_*27delGCCTGACCGTTTCCCTGCCTCCTGCTTCAGCCT		3_prime_UTR_variant	43/43		XP_024306305.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PRPF8	ENST00000304992.11	c.7003_*27delGCCTGACCGTTTCCCTGCCTCCTGCTTCAGCCT	p.Ala2335_Ter2336del	stop_lost, conservative_inframe_deletion	43/43	1	NM_006445.4	ENSP00000304350.6
PRPF8	ENST00000304992	c.7002_*27delGCCTGACCGTTTCCCTGCCTCCTGCTTCAGCCT		3_prime_UTR_variant	43/43	1	NM_006445.4	ENSP00000304350.6

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jul 03, 2022

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals affected with PRPF8-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.7003_*27del, is a complex sequence change that results in the deletion of 1 and insertion of 31 amino acid(s) in the PRPF8 protein (p.Ala2335delins31). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr17-1554068;