chr17-17219126-C-CTTCTGTACTCTCTGGCAACACAGGGGCT
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_144997.7(FLCN):c.927_954dupAGCCCCTGTGTTGCCAGAGAGTACAGAA(p.Gly319SerfsTer80) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,870 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. E318E) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_144997.7 frameshift
Scores
Clinical Significance
Conservation
Publications
- Birt-Hogg-Dube syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, ClinGen, Orphanet, Labcorp Genetics (formerly Invitae)
- Birt-Hogg-Dube syndrome 1Inheritance: AD Classification: DEFINITIVE Submitted by: G2P, Ambry Genetics
- familial spontaneous pneumothoraxInheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Genomics England PanelApp
- renal carcinomaInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- colorectal cancerInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_144997.7. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FLCN | MANE Select | c.927_954dupAGCCCCTGTGTTGCCAGAGAGTACAGAA | p.Gly319SerfsTer80 | frameshift | Exon 9 of 14 | NP_659434.2 | |||
| FLCN | c.981_1008dupAGCCCCTGTGTTGCCAGAGAGTACAGAA | p.Gly337SerfsTer80 | frameshift | Exon 11 of 16 | NP_001340158.1 | ||||
| FLCN | c.927_954dupAGCCCCTGTGTTGCCAGAGAGTACAGAA | p.Gly319SerfsTer80 | frameshift | Exon 10 of 15 | NP_001340159.1 | Q8NFG4-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FLCN | TSL:1 MANE Select | c.927_954dupAGCCCCTGTGTTGCCAGAGAGTACAGAA | p.Gly319SerfsTer80 | frameshift | Exon 9 of 14 | ENSP00000285071.4 | Q8NFG4-1 | ||
| ENSG00000264187 | TSL:1 | n.149-100_149-73dupAGCCCCTGTGTTGCCAGAGAGTACAGAA | intron | N/A | ENSP00000394249.3 | J3QW42 | |||
| FLCN | c.1032_1059dupAGCCCCTGTGTTGCCAGAGAGTACAGAA | p.Gly354SerfsTer80 | frameshift | Exon 11 of 16 | ENSP00000632788.1 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 exome AF: 6.84e-7 AC: 1AN: 1461870Hom.: 0 Cov.: 35 AF XY: 0.00 AC XY: 0AN XY: 727238 show subpopulations
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at