chr17-17793779-CCAGCAGCAGCAGCAGCAGCAG-C

Position:

• chr17-17793779-CCAGCAGCAGCAGCAGCAGCAG-C

Variant summary

Our verdict is Benign. Variant got -9 ACMG points: 0P and 9B. BP6 BS1 BS2

The ENST00000353383.6(RAI1):​c.852_872delGCAGCAGCAGCAGCAGCAGCA​(p.Gln285_Gln291del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000419 in 1,357,644 control chromosomes in the GnomAD database, including 3 homozygotes. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. Q284Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.00062 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00041 (3 hom.)
• Consequence: RAI1 ENST00000353383.6 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:5
• Conservation: PhyloP100: 4.86

Genes affected

RAI1 (HGNC:9834): (retinoic acid induced 1) This gene is located within the Smith-Magenis syndrome region on chromosome 17. It is highly similar to its mouse counterpart and is expressed at high levels mainly in neuronal tissues. The protein encoded by this gene includes a polymorphic polyglutamine tract in the N-terminal domain. Expression of the mouse counterpart in neurons is induced by retinoic acid. This gene is associated with both the severity of the phenotype and the response to medication in schizophrenic patients. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Benign. Variant got -9 ACMG points.

• BP6: Variant 17-17793779-CCAGCAGCAGCAGCAGCAGCAG-C is Benign according to our data. Variant chr17-17793779-CCAGCAGCAGCAGCAGCAGCAG-C is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 96200.We mark this variant Likely_benign, oryginal submissions are: {Benign=1, Likely_benign=3, Uncertain_significance=1}. Variant chr17-17793779-CCAGCAGCAGCAGCAGCAGCAG-C is described in Lovd as [Likely_benign].
• BS1: Variant frequency is greater than expected in population sas. gnomad4 allele frequency = 0.000622 (49/78832) while in subpopulation SAS AF= 0.00245 (2/816). AF 95% confidence interval is 0.000457. There are 0 homozygotes in gnomad4. There are 17 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 49 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
RAI1	NM_030665.4	c.852_872delGCAGCAGCAGCAGCAGCAGCA	p.Gln285_Gln291del	disruptive_inframe_deletion	3/6	ENST00000353383.6	NP_109590.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
RAI1	ENST00000353383.6	c.852_872delGCAGCAGCAGCAGCAGCAGCA	p.Gln285_Gln291del	disruptive_inframe_deletion	3/6	1	NM_030665.4	ENSP00000323074.4
RAI1	ENST00000395774.1	c.852_872delGCAGCAGCAGCAGCAGCAGCA	p.Gln285_Gln291del	disruptive_inframe_deletion	2/2	2		ENSP00000379120.1

Frequencies

GnomAD3 genomes AF: 0.000622 AC: 49 AN: 78832 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000463

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00102

Gnomad ASJ AF: 0.00102

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00245

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00562

Gnomad NFE AF: 0.000658

Gnomad OTH AF: 0.00188

GnomAD4 exome AF: 0.000407 AC: 520 AN: 1278812 Hom.: 3 AF XY: 0.000392 AC XY: 248 AN XY: 632490

Gnomad4 AFR exome AF: 0.000350

Gnomad4 AMR exome AF: 0.000662

Gnomad4 ASJ exome AF: 0.000257

Gnomad4 EAS exome AF: 0.0000537

Gnomad4 SAS exome AF: 0.000484

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000349

Gnomad4 OTH exome AF: 0.000905

GnomAD4 genome AF: 0.000622 AC: 49 AN: 78832 Hom.: 0 Cov.: 0 AF XY: 0.000454 AC XY: 17 AN XY: 37424

Gnomad4 AFR AF: 0.000463

Gnomad4 AMR AF: 0.00102

Gnomad4 ASJ AF: 0.00102

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00245

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000658

Gnomad4 OTH AF: 0.00188

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:1 Benign:5

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Uncertain:1 Benign:3

Benign, criteria provided, single submitter	clinical testing	GeneDx	Apr 20, 2020	- -
Likely benign, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Jan 22, 2024	- -
Likely benign, criteria provided, single submitter	clinical testing	CeGaT Center for Human Genetics Tuebingen	Sep 01, 2024	RAI1: BS1 -
Uncertain significance, criteria provided, single submitter	clinical testing	Eurofins Ntd Llc (ga)	Sep 13, 2013	- -

Inborn genetic diseases Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Ambry Genetics

Jan 14, 2019

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

RAI1-related disorder Benign:1

Likely benign, no assertion criteria provided

clinical testing

PreventionGenetics, part of Exact Sciences

Apr 06, 2022

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs371983878; hg19: chr17-17697093;