chr17-19648991-GGGTCCGACAGGCGTTCCTGTCCGGCC-G

Variant names:

• chr17-19648991-GGGTCCGACAGGCGTTCCTGTCCGGCC-G
• rs767751416
• NM_000382.3:c.25_50delCGACAGGCGTTCCTGTCCGGCCGGTC

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000382.3(ALDH3A2):​c.25_50delCGACAGGCGTTCCTGTCCGGCCGGTC​(p.Arg9AlafsTer36) variant causes a frameshift change. The variant allele was found at a frequency of 0.00000315 in 1,586,004 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0000028 (0 hom.)
• Consequence: ALDH3A2 NM_000382.3 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:6
• Conservation: PhyloP100: 6.41

Genes affected

ALDH3A2 (HGNC:403): (aldehyde dehydrogenase 3 family member A2) Aldehyde dehydrogenase isozymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. This gene product catalyzes the oxidation of long-chain aliphatic aldehydes to fatty acid. Mutations in the gene cause Sjogren-Larsson syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 72 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-19648991-GGGTCCGACAGGCGTTCCTGTCCGGCC-G is Pathogenic according to our data. Variant chr17-19648991-GGGTCCGACAGGCGTTCCTGTCCGGCC-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 371103.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr17-19648991-GGGTCCGACAGGCGTTCCTGTCCGGCC-G is described in Lovd as [Pathogenic]. Variant chr17-19648991-GGGTCCGACAGGCGTTCCTGTCCGGCC-G is described in Lovd as [Likely_pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ALDH3A2	NM_000382.3	c.25_50delCGACAGGCGTTCCTGTCCGGCCGGTC	p.Arg9AlafsTer36	frameshift_variant	Exon 1 of 10	ENST00000176643.11	NP_000373.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ALDH3A2	ENST00000176643.11	c.25_50delCGACAGGCGTTCCTGTCCGGCCGGTC	p.Arg9AlafsTer36	frameshift_variant	Exon 1 of 10	1	NM_000382.3	ENSP00000176643.6

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152202 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.0000241

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000279 AC: 4 AN: 1433802 Hom.: 0 AF XY: 0.00000281 AC XY: 2 AN XY: 710592

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000273

Gnomad4 OTH exome AF: 0.0000169

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152202 Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0 AN XY: 74348

Gnomad4 AFR AF: 0.0000241

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

Bravo AF: 0.0000264

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:6

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Sjögren-Larsson syndrome Pathogenic:5

Jun 01, 2017

Rizzo Lab, University of Nebraska Medical Center

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: research

- -

Jun 27, 2016

Counsyl

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Sep 16, 2020

Natera, Inc.

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Jun 21, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Dec 16, 2019

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: ALDH3A2 c.25_50del26 (p.Arg9AlafsX36) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory. The variant was absent in 194754 control chromosomes (gnomAD). c.25_50del26 has been reported in the literature in individuals affected with Sjogren-Larsson Syndrome (Willemsen_2001, Sanders_2008, Kariminejad_2017). These data indicate that the variant may be associated with disease. Sanders_2008 reports this variant has an impact on protein function and results in decreasing activity from patients fibroblast cells. Three ClinVar submitters (evaluation after 2014) cite the variant as pathogenic/likely pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -

not provided Pathogenic:1

Oct 04, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Arg9Alafs*36) in the ALDH3A2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in ALDH3A2 are known to be pathogenic (PMID: 10577908, 10854114). This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with Sjögren-Larsson syndrome (PMID: 11408337, 29183715). It has also been observed to segregate with disease in related individuals. This variant is also known as c.21-46del. ClinVar contains an entry for this variant (Variation ID: 371103). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs767751416; hg19: chr17-19552304;