chr17-19648991-GGGTCCGACAGGCGTTCCTGTCCGGCC-G
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000382.3(ALDH3A2):c.25_50delCGACAGGCGTTCCTGTCCGGCCGGTC(p.Arg9AlafsTer36) variant causes a frameshift change. The variant allele was found at a frequency of 0.00000315 in 1,586,004 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. R9R) has been classified as Likely benign.
Frequency
Consequence
NM_000382.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- Sjogren-Larsson syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Myriad Women’s Health, PanelApp Australia, Labcorp Genetics (formerly Invitae), Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152202Hom.: 0 Cov.: 33 show subpopulations
GnomAD4 exome AF: 0.00000279 AC: 4AN: 1433802Hom.: 0 AF XY: 0.00000281 AC XY: 2AN XY: 710592 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152202Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0AN XY: 74348 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
ClinVar
Submissions by phenotype
Sjögren-Larsson syndrome Pathogenic:5
Variant summary: ALDH3A2 c.25_50del26 (p.Arg9AlafsX36) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory. The variant was absent in 194754 control chromosomes (gnomAD). c.25_50del26 has been reported in the literature in individuals affected with Sjogren-Larsson Syndrome (Willemsen_2001, Sanders_2008, Kariminejad_2017). These data indicate that the variant may be associated with disease. Sanders_2008 reports this variant has an impact on protein function and results in decreasing activity from patients fibroblast cells. Three ClinVar submitters (evaluation after 2014) cite the variant as pathogenic/likely pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -
- -
This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com. -
- -
- -
not provided Pathogenic:1
This sequence change creates a premature translational stop signal (p.Arg9Alafs*36) in the ALDH3A2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in ALDH3A2 are known to be pathogenic (PMID: 10577908, 10854114). This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with Sjögren-Larsson syndrome (PMID: 11408337, 29183715). It has also been observed to segregate with disease in related individuals. This variant is also known as c.21-46del. ClinVar contains an entry for this variant (Variation ID: 371103). For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at