chr17-58703293-T-TTATCTTCTTCCAGATTTCCTTTCAGAACACTCAAAGGTATGAGTCAGACTACTGAAATGTAACTAACCAAGTATTTTTTGAGGTGTTTGATAAGCATGAA

Position:

• chr17-58703293-T-TTATCTTCTTCCAGATTTCCTTTCAGAACACTCAAAGGTATGAGTCAGACTACTGAAATGTAACTAACCAAGTATTTTTTGAGGTGTTTGATAAGCATGAA

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_058216.3(RAD51C):​c.670_705+64dup variant causes a stop gained, frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. V223V) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 31)
• Consequence: RAD51C NM_058216.3 stop_gained, frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.11

Genes affected

RAD51C (HGNC:9820): (RAD51 paralog C) This gene is a member of the RAD51 family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51 and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with other RAD51 paralogs and is reported to be important for Holliday junction resolution. Mutations in this gene are associated with Fanconi anemia-like syndrome. This gene is one of four localized to a region of chromosome 17q23 where amplification occurs frequently in breast tumors. Overexpression of the four genes during amplification has been observed and suggests a possible role in tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
RAD51C	NM_058216.3	c.670_705+64dup		stop_gained, frameshift_variant	4/9	ENST00000337432.9

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
RAD51C	ENST00000337432.9	c.670_705+64dup		stop_gained, frameshift_variant	4/9	1	NM_058216.3	P2

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Fanconi anemia complementation group O Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Invitae

Jan 06, 2015

This variant is a tandem duplication of the genomic region encompassing the last 36 nucleotides of exon 4 and the first 64 nucleotides of intron 4 (c.670_705+64dup). This results in the insertion of 100 nucleotides in intron 4 of the RAD51C mRNA. This variant has not been published in the literature and is not present in population databases. Algorithms developed to predict the effect of sequence changes on mRNA splicing suggest that this variant does not alter mRNA splicing at the consensus splice site, but may alter mRNA splicing through the creation of a novel acceptor splice site. However, these predictions have not been confirmed by published transcriptional studies. In summary, this is a novel duplication with uncertain impact on mRNA splicing and protein function. It has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555597210; hg19: chr17-56780654;