chr17-63477128-CTGCTGCTGCCGCTGCCGCTGCTGT-C
Variant summary
Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM1PM2PP5
The NM_000789.4(ACE):c.47_70delTGCCGCTGCTGTTGCTGCTGCCGC(p.Leu16_Pro23del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000248 in 1,409,218 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_000789.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 5 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
ACE | NM_000789.4 | c.47_70delTGCCGCTGCTGTTGCTGCTGCCGC | p.Leu16_Pro23del | disruptive_inframe_deletion | Exon 1 of 25 | ENST00000290866.10 | NP_000780.1 | |
ACE | NM_001382700.1 | c.-189_-166delTGCCGCTGCTGTTGCTGCTGCCGC | 5_prime_UTR_variant | Exon 1 of 22 | NP_001369629.1 | |||
ACE | NM_001382701.1 | c.-568_-545delTGCCGCTGCTGTTGCTGCTGCCGC | 5_prime_UTR_variant | Exon 1 of 23 | NP_001369630.1 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000205 AC: 31AN: 151230Hom.: 0 Cov.: 31
GnomAD3 exomes AF: 0.000127 AC: 8AN: 62808Hom.: 0 AF XY: 0.000110 AC XY: 4AN XY: 36344
GnomAD4 exome AF: 0.000253 AC: 318AN: 1257988Hom.: 0 AF XY: 0.000225 AC XY: 139AN XY: 618570
GnomAD4 genome AF: 0.000205 AC: 31AN: 151230Hom.: 0 Cov.: 31 AF XY: 0.000217 AC XY: 16AN XY: 73844
ClinVar
Submissions by phenotype
not provided Pathogenic:1Uncertain:1
This variant, c.47_70del, results in the deletion of 8 amino acid(s) of the ACE protein (p.Leu16_Pro23del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (no rsID available, gnomAD 0.04%). This variant has been observed in individuals with renal tubular dysgenesis (PMID: 22095942, 35848000). ClinVar contains an entry for this variant (Variation ID: 1219086). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
In-frame deletion of 8 amino acids in a non-repeat region predicted to critically alter the protein; In silico analysis supports a deleterious effect on protein structure/function; This variant is associated with the following publications: (PMID: 22095942) -
ACE-related disorder Pathogenic:1
The ACE c.47_70del24 variant is predicted to result in an in-frame deletion (p.Leu16_Pro23del). This variant has been reported in the homozygous and compound heterozygous state in multiple individuals with autosomal recessive renal tubular dysgenesis (Table 2, Gribouval et al. 2012. PubMed ID: 22095942; Gaffar et al. 2022. PubMed ID: 35848000). Deletions of one or multiple leucine residues in exon 1 of the ACE gene have been commonly reported to be pathogenic for autosomal recessive renal tubular dysgenesis secondary to disrupted translocation of the protein to the endoplasmic reticulum (Gribouval et al. 2010. PubMed ID: 20607303). This variant is reported in 0.018% of alleles in individuals of European (non-Finnish) descent in gnomAD and is interpreted as likely pathogenic/pathogenic in ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/variation/1219086/). In summary, we classify this variant as pathogenic. -
Microvascular complications of diabetes, susceptibility to, 3;C3281105:Hemorrhage, intracerebral, susceptibility to;C5681536:Renal tubular dysgenesis of genetic origin Pathogenic:1
- -
Renal tubular dysgenesis Pathogenic:1
This 24 base pair in-frame deletion variant found in exon 1 of 25 leads to the loss of 8 amino acid residues. This variant has been previously reported in the homozygous state in two individuals and the compound heterozygous state with a pathogenic truncating variant in one individual with Renal Tubular Dysgenesis (PMID: 22095942). These individuals exhibited high renin expression, indicating a loss of ACE protein function. Variants in exon 1 of the ACE gene that completely disrupt the signal peptide sequence or result in the deletion of one or several leucine residues are predicted to prevent the normal translocation of the protein to the endoplasmic reticulum (PMID: 22095942, 19664745). This variant is present in the heterozygous state in the gnomAD population database at a frequency of 0.0096% (9/93296) and thus is presumed to be rare. Based on the available evidence, the c.47_70del (p.Leu16_Pro23del) variant is classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at