chr19-11128017-ACGTTGCTGGCAGAGGAAATGAGAAGAAGCC-A
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4PP5_Moderate
The NM_000527.5(LDLR):c.2323_2352delGTTGCTGGCAGAGGAAATGAGAAGAAGCCC(p.Val775_Pro784del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. V775V) has been classified as Likely benign.
Frequency
Consequence
NM_000527.5 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- hypercholesterolemia, familial, 1Inheritance: AD, SD Classification: DEFINITIVE, STRONG Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, ClinGen
- homozygous familial hypercholesterolemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000527.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LDLR | MANE Select | c.2323_2352delGTTGCTGGCAGAGGAAATGAGAAGAAGCCC | p.Val775_Pro784del | conservative_inframe_deletion | Exon 16 of 18 | NP_000518.1 | P01130-1 | ||
| LDLR | c.2323_2352delGTTGCTGGCAGAGGAAATGAGAAGAAGCCC | p.Val775_Pro784del | conservative_inframe_deletion | Exon 16 of 18 | NP_001182727.1 | P01130-5 | |||
| LDLR | c.2200_2229delGTTGCTGGCAGAGGAAATGAGAAGAAGCCC | p.Val734_Pro743del | conservative_inframe_deletion | Exon 15 of 17 | NP_001182728.1 | P01130-4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LDLR | TSL:1 MANE Select | c.2323_2352delGTTGCTGGCAGAGGAAATGAGAAGAAGCCC | p.Val775_Pro784del | conservative_inframe_deletion | Exon 16 of 18 | ENSP00000454071.1 | P01130-1 | ||
| LDLR | TSL:1 | c.2581_2610delGTTGCTGGCAGAGGAAATGAGAAGAAGCCC | p.Val861_Pro870del | conservative_inframe_deletion | Exon 16 of 18 | ENSP00000252444.6 | J3KMZ9 | ||
| LDLR | TSL:1 | c.2323_2352delGTTGCTGGCAGAGGAAATGAGAAGAAGCCC | p.Val775_Pro784del | conservative_inframe_deletion | Exon 16 of 18 | ENSP00000453346.1 | P01130-5 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at