chr19-13207858-C-CCTGCTGCTGCTGCTGCTGCTGCTG

Variant names:

• chr19-13207858-C-CCTGCTGCTGCTGCTGCTGCTGCTG
• NM_001127222.2:c.6952_6975dupCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_001127222.2(CACNA1A):​c.6952_6975dupCAGCAGCAGCAGCAGCAGCAGCAG​(p.Gln2318_Gln2325dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 0)
  • Exomes 𝑓: 0.000012 (0 hom.)
• Consequence: CACNA1A NM_001127222.2 conservative_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.00

Genes affected

CACNA1A (HGNC:1388): (calcium voltage-gated channel subunit alpha1 A) Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAdExome4 at 16 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CACNA1A	NM_001127222.2	c.6952_6975dupCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2318_Gln2325dup	conservative_inframe_insertion	Exon 47 of 47	ENST00000360228.11	NP_001120694.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CACNA1A	ENST00000360228.11	c.6952_6975dupCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2318_Gln2325dup	conservative_inframe_insertion	Exon 47 of 47	1	NM_001127222.2	ENSP00000353362.5
CACNA1A	ENST00000638029.1	c.6970_6993dupCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2324_Gln2331dup	conservative_inframe_insertion	Exon 48 of 48	5		ENSP00000489829.1
CACNA1A	ENST00000573710.7	c.6958_6981dupCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2320_Gln2327dup	conservative_inframe_insertion	Exon 47 of 47	5		ENSP00000460092.3
CACNA1A	ENST00000635727.1	c.6955_6978dupCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2319_Gln2326dup	conservative_inframe_insertion	Exon 47 of 47	5		ENSP00000490001.1
CACNA1A	ENST00000637769.1	c.6955_6978dupCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2319_Gln2326dup	conservative_inframe_insertion	Exon 47 of 47	1		ENSP00000489778.1
CACNA1A	ENST00000636012.1	c.6919_6942dupCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2307_Gln2314dup	conservative_inframe_insertion	Exon 46 of 46	5		ENSP00000490223.1
CACNA1A	ENST00000637736.1	c.6814_6837dupCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2272_Gln2279dup	conservative_inframe_insertion	Exon 46 of 46	5		ENSP00000489861.1
CACNA1A	ENST00000636389	c.*38_*61dupCAGCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	Exon 47 of 47	5		ENSP00000489992.1
CACNA1A	ENST00000637432	c.*164_*187dupCAGCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	Exon 48 of 48	5		ENSP00000490617.1
CACNA1A	ENST00000635895	c.*164_*187dupCAGCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	Exon 47 of 47	5		ENSP00000490323.1
CACNA1A	ENST00000638009	c.*164_*187dupCAGCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	Exon 47 of 47	1		ENSP00000489913.1
CACNA1A	ENST00000637276	c.*164_*187dupCAGCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	Exon 46 of 46	5		ENSP00000489777.1
CACNA1A	ENST00000636549.1	c.*164_*187dupCAGCAGCAGCAGCAGCAGCAGCAG		downstream_gene_variant		5		ENSP00000490578.1
CACNA1A	ENST00000637927.1	c.*164_*187dupCAGCAGCAGCAGCAGCAGCAGCAG		downstream_gene_variant		5		ENSP00000489715.1

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome AF: 0.0000125 AC: 16 AN: 1283938 Hom.: 0 Cov.: 0 AF XY: 0.00000791 AC XY: 5 AN XY: 631946

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000304

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000681

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr19-13318672;