chr19-13207858-CCTGCTGCTGCTGCTGCTGCTGCTGCTG-C

Variant names:

• chr19-13207858-CCTGCTGCTGCTGCTGCTGCTGCTGCTG-C
• rs16054
• NM_001127222.2:c.6949_6975delCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Benign. Variant got -16 ACMG points: 0P and 16B. BP6_Very_Strong BS1 BS2

The NM_001127222.2(CACNA1A):​c.6949_6975delCAGCAGCAGCAGCAGCAGCAGCAGCAG​(p.Gln2317_Gln2325del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00712 in 1,431,364 control chromosomes in the GnomAD database, including 69 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0075 (11 hom., cov: 0)
  • Exomes 𝑓: 0.0071 (58 hom.)
• Consequence: CACNA1A NM_001127222.2 conservative_inframe_deletion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:4
• Conservation: PhyloP100: 0.785

Genes affected

CACNA1A (HGNC:1388): (calcium voltage-gated channel subunit alpha1 A) Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -16 ACMG points.

• BP6: Variant 19-13207858-CCTGCTGCTGCTGCTGCTGCTGCTGCTG-C is Benign according to our data. Variant chr19-13207858-CCTGCTGCTGCTGCTGCTGCTGCTGCTG-C is described in ClinVar as [Likely_benign]. Clinvar id is 982691.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr19-13207858-CCTGCTGCTGCTGCTGCTGCTGCTGCTG-C is described in Lovd as [Likely_benign].
• BS1: Variant frequency is greater than expected in population amr. gnomad4 allele frequency = 0.00748 (1106/147898) while in subpopulation AMR AF= 0.0203 (304/14966). AF 95% confidence interval is 0.0184. There are 11 homozygotes in gnomad4. There are 572 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 1106 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CACNA1A	NM_001127222.2	c.6949_6975delCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2317_Gln2325del	conservative_inframe_deletion	Exon 47 of 47	ENST00000360228.11	NP_001120694.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CACNA1A	ENST00000360228.11	c.6949_6975delCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2317_Gln2325del	conservative_inframe_deletion	Exon 47 of 47	1	NM_001127222.2	ENSP00000353362.5
CACNA1A	ENST00000638029.1	c.6967_6993delCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2323_Gln2331del	conservative_inframe_deletion	Exon 48 of 48	5		ENSP00000489829.1
CACNA1A	ENST00000573710.7	c.6955_6981delCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2319_Gln2327del	conservative_inframe_deletion	Exon 47 of 47	5		ENSP00000460092.3
CACNA1A	ENST00000635727.1	c.6952_6978delCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2318_Gln2326del	conservative_inframe_deletion	Exon 47 of 47	5		ENSP00000490001.1
CACNA1A	ENST00000637769.1	c.6952_6978delCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2318_Gln2326del	conservative_inframe_deletion	Exon 47 of 47	1		ENSP00000489778.1
CACNA1A	ENST00000636012.1	c.6916_6942delCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2306_Gln2314del	conservative_inframe_deletion	Exon 46 of 46	5		ENSP00000490223.1
CACNA1A	ENST00000637736.1	c.6811_6837delCAGCAGCAGCAGCAGCAGCAGCAGCAG	p.Gln2271_Gln2279del	conservative_inframe_deletion	Exon 46 of 46	5		ENSP00000489861.1
CACNA1A	ENST00000636389	c.*35_*61delCAGCAGCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	Exon 47 of 47	5		ENSP00000489992.1
CACNA1A	ENST00000637432	c.*161_*187delCAGCAGCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	Exon 48 of 48	5		ENSP00000490617.1
CACNA1A	ENST00000635895	c.*161_*187delCAGCAGCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	Exon 47 of 47	5		ENSP00000490323.1
CACNA1A	ENST00000638009	c.*161_*187delCAGCAGCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	Exon 47 of 47	1		ENSP00000489913.1
CACNA1A	ENST00000637276	c.*161_*187delCAGCAGCAGCAGCAGCAGCAGCAGCAG		3_prime_UTR_variant	Exon 46 of 46	5		ENSP00000489777.1
CACNA1A	ENST00000636549.1	c.*161_*187delCAGCAGCAGCAGCAGCAGCAGCAGCAG		downstream_gene_variant		5		ENSP00000490578.1
CACNA1A	ENST00000637927.1	c.*161_*187delCAGCAGCAGCAGCAGCAGCAGCAGCAG		downstream_gene_variant		5		ENSP00000489715.1

Frequencies

GnomAD3 genomes AF: 0.00745 AC: 1101 AN: 147796 Hom.: 10 Cov.: 0

Gnomad AFR AF: 0.00210

Gnomad AMI AF: 0.0402

Gnomad AMR AF: 0.0202

Gnomad ASJ AF: 0.000291

Gnomad EAS AF: 0.00973

Gnomad SAS AF: 0.00955

Gnomad FIN AF: 0.00623

Gnomad MID AF: 0.00333

Gnomad NFE AF: 0.00755

Gnomad OTH AF: 0.00989

GnomAD4 exome AF: 0.00708 AC: 9090 AN: 1283466 Hom.: 58 AF XY: 0.00706 AC XY: 4461 AN XY: 631668

Gnomad4 AFR exome AF: 0.00152

Gnomad4 AMR exome AF: 0.0108

Gnomad4 ASJ exome AF: 0.000368

Gnomad4 EAS exome AF: 0.00764

Gnomad4 SAS exome AF: 0.00545

Gnomad4 FIN exome AF: 0.00674

Gnomad4 NFE exome AF: 0.00740

Gnomad4 OTH exome AF: 0.00676

GnomAD4 genome AF: 0.00748 AC: 1106 AN: 147898 Hom.: 11 Cov.: 0 AF XY: 0.00794 AC XY: 572 AN XY: 71998

Gnomad4 AFR AF: 0.00206

Gnomad4 AMR AF: 0.0203

Gnomad4 ASJ AF: 0.000291

Gnomad4 EAS AF: 0.00976

Gnomad4 SAS AF: 0.00935

Gnomad4 FIN AF: 0.00623

Gnomad4 NFE AF: 0.00755

Gnomad4 OTH AF: 0.0122

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:2

Jun 02, 2021

GeneDx

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Mar 01, 2025

CeGaT Center for Human Genetics Tuebingen

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

CACNA1A: BS1, BS2 -

CACNA1A-related disorder Benign:1

Sep 10, 2019

PreventionGenetics, part of Exact Sciences

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Developmental and epileptic encephalopathy, 42 Benign:1

Jan 01, 2019

Institute of Human Genetics, University of Leipzig Medical Center

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs16054; hg19: chr19-13318672;