chr19-13286739-ATGGGGCCGGGGTCGGTGCTGTTTCCCATCTTGGCTGGGCTCTGGGGCAGGCCGGCG-A

Variant names:

• chr19-13286739-ATGGGGCCGGGGTCGGTGCTGTTTCCCATCTTGGCTGGGCTCTGGGGCAGGCCGGCG-A
• rs1555752975
• NM_001127222.2:c.3261_3316delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_001127222.2(CACNA1A):​c.3261_3316delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA​(p.Leu1090HisfsTer35) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. H1087H) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 30)
• Consequence: CACNA1A NM_001127222.2 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.69

Genes affected

CACNA1A (HGNC:1388): (calcium voltage-gated channel subunit alpha1 A) Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 19-13286739-ATGGGGCCGGGGTCGGTGCTGTTTCCCATCTTGGCTGGGCTCTGGGGCAGGCCGGCG-A is Pathogenic according to our data. Variant chr19-13286739-ATGGGGCCGGGGTCGGTGCTGTTTCCCATCTTGGCTGGGCTCTGGGGCAGGCCGGCG-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 446917.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CACNA1A	NM_001127222.2	c.3261_3316delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA	p.Leu1090HisfsTer35	frameshift_variant	Exon 20 of 47	ENST00000360228.11	NP_001120694.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CACNA1A	ENST00000360228.11	c.3261_3316delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA	p.Leu1090HisfsTer35	frameshift_variant	Exon 20 of 47	1	NM_001127222.2	ENSP00000353362.5
CACNA1A	ENST00000638029.1	c.3273_3328delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA	p.Leu1094HisfsTer35	frameshift_variant	Exon 20 of 48	5		ENSP00000489829.1
CACNA1A	ENST00000573710.7	c.3267_3322delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA	p.Leu1092HisfsTer35	frameshift_variant	Exon 20 of 47	5		ENSP00000460092.3
CACNA1A	ENST00000635727.1	c.3264_3319delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA	p.Leu1091HisfsTer35	frameshift_variant	Exon 20 of 47	5		ENSP00000490001.1
CACNA1A	ENST00000637769.1	c.3264_3319delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA	p.Leu1091HisfsTer35	frameshift_variant	Exon 20 of 47	1		ENSP00000489778.1
CACNA1A	ENST00000636012.1	c.3264_3319delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA	p.Leu1091HisfsTer35	frameshift_variant	Exon 20 of 46	5		ENSP00000490223.1
CACNA1A	ENST00000637736.1	c.3123_3178delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA	p.Leu1044HisfsTer35	frameshift_variant	Exon 19 of 46	5		ENSP00000489861.1
CACNA1A	ENST00000636389.1	c.3264_3319delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA	p.Leu1091HisfsTer35	frameshift_variant	Exon 20 of 47	5		ENSP00000489992.1
CACNA1A	ENST00000637432.1	c.3273_3328delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA	p.Leu1094HisfsTer35	frameshift_variant	Exon 20 of 48	5		ENSP00000490617.1
CACNA1A	ENST00000636549.1	c.3264_3319delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA	p.Leu1091HisfsTer35	frameshift_variant	Exon 20 of 48	5		ENSP00000490578.1
CACNA1A	ENST00000637927.1	c.3267_3322delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA	p.Leu1092HisfsTer35	frameshift_variant	Exon 20 of 47	5		ENSP00000489715.1
CACNA1A	ENST00000635895.1	c.3264_3319delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA	p.Leu1091HisfsTer35	frameshift_variant	Exon 20 of 47	5		ENSP00000490323.1
CACNA1A	ENST00000638009.2	c.3264_3319delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA	p.Leu1091HisfsTer35	frameshift_variant	Exon 20 of 47	1		ENSP00000489913.1
CACNA1A	ENST00000637276.1	c.3264_3319delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA	p.Leu1091HisfsTer35	frameshift_variant	Exon 20 of 46	5		ENSP00000489777.1

Frequencies

GnomAD3 genomes Cov.: 30

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 30

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Jan 06, 2017

Athena Diagnostics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555752975; hg19: chr19-13397553;