chr19-13286739-ATGGGGCCGGGGTCGGTGCTGTTTCCCATCTTGGCTGGGCTCTGGGGCAGGCCGGCG-A

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_001127222.2(CACNA1A):​c.3261_3316delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA​(p.Leu1090HisfsTer35) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. H1087H) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 30)

Consequence

CACNA1A
NM_001127222.2 frameshift

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 2.69

Publications

0 publications found
Variant links:
Genes affected
CACNA1A (HGNC:1388): (calcium voltage-gated channel subunit alpha1 A) Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
CACNA1A Gene-Disease associations (from GenCC):
  • episodic ataxia type 2
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
  • undetermined early-onset epileptic encephalopathy
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Illumina
  • developmental and epileptic encephalopathy, 42
    Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
  • migraine, familial hemiplegic, 1
    Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
  • spinocerebellar ataxia type 6
    Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
  • benign paroxysmal torticollis of infancy
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • familial or sporadic hemiplegic migraine
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • Lennox-Gastaut syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 19-13286739-ATGGGGCCGGGGTCGGTGCTGTTTCCCATCTTGGCTGGGCTCTGGGGCAGGCCGGCG-A is Pathogenic according to our data. Variant chr19-13286739-ATGGGGCCGGGGTCGGTGCTGTTTCCCATCTTGGCTGGGCTCTGGGGCAGGCCGGCG-A is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 446917.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CACNA1ANM_001127222.2 linkc.3261_3316delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA p.Leu1090HisfsTer35 frameshift_variant Exon 20 of 47 ENST00000360228.11 NP_001120694.1 O00555-8

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CACNA1AENST00000360228.11 linkc.3261_3316delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA p.Leu1090HisfsTer35 frameshift_variant Exon 20 of 47 1 NM_001127222.2 ENSP00000353362.5 O00555-8
CACNA1AENST00000638029.1 linkc.3273_3328delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA p.Leu1094HisfsTer35 frameshift_variant Exon 20 of 48 5 ENSP00000489829.1 A0A087WW63
CACNA1AENST00000573710.7 linkc.3267_3322delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA p.Leu1092HisfsTer35 frameshift_variant Exon 20 of 47 5 ENSP00000460092.3 A0A1C7CYY9
CACNA1AENST00000635727.1 linkc.3264_3319delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA p.Leu1091HisfsTer35 frameshift_variant Exon 20 of 47 5 ENSP00000490001.1 A0A1B0GU81
CACNA1AENST00000637769.1 linkc.3264_3319delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA p.Leu1091HisfsTer35 frameshift_variant Exon 20 of 47 1 ENSP00000489778.1 A0A1B0GTN7
CACNA1AENST00000636012.1 linkc.3264_3319delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA p.Leu1091HisfsTer35 frameshift_variant Exon 20 of 46 5 ENSP00000490223.1 A0A1B0GUS3
CACNA1AENST00000637736.1 linkc.3123_3178delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA p.Leu1044HisfsTer35 frameshift_variant Exon 19 of 46 5 ENSP00000489861.1 A0A1B0GTW2
CACNA1AENST00000636389.1 linkc.3264_3319delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA p.Leu1091HisfsTer35 frameshift_variant Exon 20 of 47 5 ENSP00000489992.1 A0A1B0GU74
CACNA1AENST00000637432.1 linkc.3273_3328delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA p.Leu1094HisfsTer35 frameshift_variant Exon 20 of 48 5 ENSP00000490617.1 O00555-2
CACNA1AENST00000636549.1 linkc.3264_3319delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA p.Leu1091HisfsTer35 frameshift_variant Exon 20 of 48 5 ENSP00000490578.1 B5TYJ1
CACNA1AENST00000637927.1 linkc.3267_3322delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA p.Leu1092HisfsTer35 frameshift_variant Exon 20 of 47 5 ENSP00000489715.1 A0A1B0GTI4
CACNA1AENST00000635895.1 linkc.3264_3319delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA p.Leu1091HisfsTer35 frameshift_variant Exon 20 of 47 5 ENSP00000490323.1 A0A384DVW2
CACNA1AENST00000638009.2 linkc.3264_3319delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA p.Leu1091HisfsTer35 frameshift_variant Exon 20 of 47 1 ENSP00000489913.1 O00555-3
CACNA1AENST00000637276.1 linkc.3264_3319delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA p.Leu1091HisfsTer35 frameshift_variant Exon 20 of 46 5 ENSP00000489777.1 O00555-5
CACNA1AENST00000636768.2 linkn.3264_3319delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA non_coding_transcript_exon_variant Exon 20 of 45 5 ENSP00000490190.2 A0A1B0GUP3
CACNA1AENST00000713789.1 linkn.3261_3316delCGCCGGCCTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCA non_coding_transcript_exon_variant Exon 20 of 47 ENSP00000519091.1

Frequencies

GnomAD3 genomes
Cov.:
30
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
30

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Pathogenic:1
Jan 06, 2017
Athena Diagnostics
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
2.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555752975; hg19: chr19-13397553; API