chr19-13299295-C-CACTGGTCCGCTGCTCCCACACGGACTTG
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_001127222.2(CACNA1A):c.2310_2337dupCAAGTCCGTGTGGGAGCAGCGGACCAGT(p.Glu780GlnfsTer10) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 32)
Consequence
CACNA1A
NM_001127222.2 frameshift
NM_001127222.2 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 0.0650
Genes affected
CACNA1A (HGNC:1388): (calcium voltage-gated channel subunit alpha1 A) Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 19-13299295-C-CACTGGTCCGCTGCTCCCACACGGACTTG is Pathogenic according to our data. Variant chr19-13299295-C-CACTGGTCCGCTGCTCCCACACGGACTTG is described in ClinVar as [Pathogenic]. Clinvar id is 377185.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CACNA1A | ENST00000360228.11 | c.2310_2337dupCAAGTCCGTGTGGGAGCAGCGGACCAGT | p.Glu780GlnfsTer10 | frameshift_variant | Exon 19 of 47 | 1 | NM_001127222.2 | ENSP00000353362.5 | ||
CACNA1A | ENST00000638029.1 | c.2322_2349dupCAAGTCCGTGTGGGAGCAGCGGACCAGT | p.Glu784GlnfsTer10 | frameshift_variant | Exon 19 of 48 | 5 | ENSP00000489829.1 | |||
CACNA1A | ENST00000573710.7 | c.2316_2343dupCAAGTCCGTGTGGGAGCAGCGGACCAGT | p.Glu782GlnfsTer10 | frameshift_variant | Exon 19 of 47 | 5 | ENSP00000460092.3 | |||
CACNA1A | ENST00000635727.1 | c.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT | p.Glu781GlnfsTer10 | frameshift_variant | Exon 19 of 47 | 5 | ENSP00000490001.1 | |||
CACNA1A | ENST00000637769.1 | c.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT | p.Glu781GlnfsTer10 | frameshift_variant | Exon 19 of 47 | 1 | ENSP00000489778.1 | |||
CACNA1A | ENST00000636012.1 | c.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT | p.Glu781GlnfsTer10 | frameshift_variant | Exon 19 of 46 | 5 | ENSP00000490223.1 | |||
CACNA1A | ENST00000637736.1 | c.2172_2199dupCAAGTCCGTGTGGGAGCAGCGGACCAGT | p.Glu734GlnfsTer10 | frameshift_variant | Exon 18 of 46 | 5 | ENSP00000489861.1 | |||
CACNA1A | ENST00000636389.1 | c.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT | p.Glu781GlnfsTer10 | frameshift_variant | Exon 19 of 47 | 5 | ENSP00000489992.1 | |||
CACNA1A | ENST00000637432.1 | c.2322_2349dupCAAGTCCGTGTGGGAGCAGCGGACCAGT | p.Glu784GlnfsTer10 | frameshift_variant | Exon 19 of 48 | 5 | ENSP00000490617.1 | |||
CACNA1A | ENST00000636549.1 | c.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT | p.Glu781GlnfsTer10 | frameshift_variant | Exon 19 of 48 | 5 | ENSP00000490578.1 | |||
CACNA1A | ENST00000637927.1 | c.2316_2343dupCAAGTCCGTGTGGGAGCAGCGGACCAGT | p.Glu782GlnfsTer10 | frameshift_variant | Exon 19 of 47 | 5 | ENSP00000489715.1 | |||
CACNA1A | ENST00000635895.1 | c.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT | p.Glu781GlnfsTer10 | frameshift_variant | Exon 19 of 47 | 5 | ENSP00000490323.1 | |||
CACNA1A | ENST00000638009.2 | c.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT | p.Glu781GlnfsTer10 | frameshift_variant | Exon 19 of 47 | 1 | ENSP00000489913.1 | |||
CACNA1A | ENST00000637276.1 | c.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT | p.Glu781GlnfsTer10 | frameshift_variant | Exon 19 of 46 | 5 | ENSP00000489777.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
GnomAD4 exome Cov.: 32
GnomAD4 exome
Cov.:
32
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
not provided Pathogenic:1
Aug 29, 2016
Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing
- -
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at