chr19-18155941-A-AGGACCTGGAGCTGCTGCCCGGCGAC

Variant names:

• chr19-18155941-A-AGGACCTGGAGCTGCTGCCCGGCGAC
• rs2043673731
• NM_005027.4:c.64_88dupGACCTGGAGCTGCTGCCCGGCGACG

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Strong PM2

The NM_005027.4(PIK3R2):​c.64_88dupGACCTGGAGCTGCTGCCCGGCGACG​(p.Val30GlyfsTer48) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: PIK3R2 NM_005027.4 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.44

Genes affected

PIK3R2 (HGNC:8980): (phosphoinositide-3-kinase regulatory subunit 2) Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Three transcript variants, one protein coding and the other two non-protein coding, have been found for this gene. [provided by RefSeq, Apr 2019]

ENSG00000268173 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 5 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PIK3R2	NM_005027.4	c.64_88dupGACCTGGAGCTGCTGCCCGGCGACG	p.Val30GlyfsTer48	frameshift_variant	Exon 2 of 16	ENST00000222254.13	NP_005018.2
PIK3R2	NR_073517.2	n.619_643dupGACCTGGAGCTGCTGCCCGGCGACG		non_coding_transcript_exon_variant	Exon 2 of 16
PIK3R2	NR_162071.1	n.619_643dupGACCTGGAGCTGCTGCCCGGCGACG		non_coding_transcript_exon_variant	Exon 2 of 15

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PIK3R2	ENST00000222254.13	c.64_88dupGACCTGGAGCTGCTGCCCGGCGACG	p.Val30GlyfsTer48	frameshift_variant	Exon 2 of 16	1	NM_005027.4	ENSP00000222254.6
ENSG00000268173	ENST00000593731.1	n.64_88dupGACCTGGAGCTGCTGCCCGGCGACG		non_coding_transcript_exon_variant	Exon 2 of 25	2		ENSP00000471914.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 1 Uncertain:1

Jan 28, 2020

Centre for Mendelian Genomics, University Medical Centre Ljubljana

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant was classified as: Uncertain significance. The available evidence on this variant's pathogenicity is insufficient or conflicting. The following ACMG criteria were applied in classifying this variant: PM2. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs2043673731; hg19: chr19-18266751;