chr19-35511468-A-ACCACTGCTGCCGCCACTGCTGCCG
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_033317.5(DMKN):c.837_860dupCGGCAGCAGTGGCGGCAGCAGTGG(p.Gly287_Gly288insGlySerSerGlyGlySerSerGly) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000238 in 84,158 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_033317.5 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_033317.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DMKN | NM_033317.5 | MANE Select | c.837_860dupCGGCAGCAGTGGCGGCAGCAGTGG | p.Gly287_Gly288insGlySerSerGlyGlySerSerGly | disruptive_inframe_insertion | Exon 5 of 16 | NP_201574.4 | ||
| DMKN | NM_001190348.2 | c.837_860dupCGGCAGCAGTGGCGGCAGCAGTGG | p.Gly287_Gly288insGlySerSerGlyGlySerSerGly | disruptive_inframe_insertion | Exon 5 of 13 | NP_001177277.1 | Q6E0U4-6 | ||
| DMKN | NM_001126057.3 | c.837_860dupCGGCAGCAGTGGCGGCAGCAGTGG | p.Gly287_Gly288insGlySerSerGlyGlySerSerGly | disruptive_inframe_insertion | Exon 5 of 11 | NP_001119529.2 | Q6E0U4-5 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DMKN | ENST00000339686.8 | TSL:1 MANE Select | c.837_860dupCGGCAGCAGTGGCGGCAGCAGTGG | p.Gly287_Gly288insGlySerSerGlyGlySerSerGly | disruptive_inframe_insertion | Exon 5 of 16 | ENSP00000342012.3 | Q6E0U4-1 | |
| DMKN | ENST00000447113.6 | TSL:1 | c.837_860dupCGGCAGCAGTGGCGGCAGCAGTGG | p.Gly287_Gly288insGlySerSerGlyGlySerSerGly | disruptive_inframe_insertion | Exon 5 of 13 | ENSP00000394908.2 | Q6E0U4-6 | |
| DMKN | ENST00000424570.6 | TSL:1 | c.837_860dupCGGCAGCAGTGGCGGCAGCAGTGG | p.Gly287_Gly288insGlySerSerGlyGlySerSerGly | disruptive_inframe_insertion | Exon 5 of 11 | ENSP00000388404.2 | Q6E0U4-5 |
Frequencies
GnomAD3 genomes AF: 0.0000238 AC: 2AN: 84158Hom.: 0 Cov.: 22 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000306 AC: 31AN: 1011784Hom.: 0 Cov.: 29 AF XY: 0.0000300 AC XY: 15AN XY: 500146 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000238 AC: 2AN: 84158Hom.: 0 Cov.: 22 AF XY: 0.00 AC XY: 0AN XY: 40894 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at