chr19-35511468-ACCACTGCTGCCGCCACTGCTGCCG-A

Variant names:

• chr19-35511468-ACCACTGCTGCCGCCACTGCTGCCG-A
• rs760401945
• NM_033317.5:c.837_860delCGGCAGCAGTGGCGGCAGCAGTGG

Variant summary

Our verdict is Likely benign. The variant received -6 ACMG points: 2P and 8B. PM4 BA1

The NM_033317.5(DMKN):​c.837_860delCGGCAGCAGTGGCGGCAGCAGTGG​(p.Gly280_Gly287del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00364 in 1,095,872 control chromosomes in the GnomAD database, including 32 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.016 (14 hom., cov: 22)
  • Exomes 𝑓: 0.0026 (18 hom.)
• Consequence: DMKN NM_033317.5 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.49
• Publications: 0 publications found

Genes affected

DMKN (HGNC:25063): (dermokine) This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

ACMG classification

Our verdict: Likely_benign. The variant received -6 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_033317.5.
• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.0658 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_033317.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DMKN	NM_033317.5	MANE Select	c.837_860delCGGCAGCAGTGGCGGCAGCAGTGG	p.Gly280_Gly287del	disruptive_inframe_deletion	Exon 5 of 16	NP_201574.4
	DMKN	NM_001190348.2		c.837_860delCGGCAGCAGTGGCGGCAGCAGTGG	p.Gly280_Gly287del	disruptive_inframe_deletion	Exon 5 of 13	NP_001177277.1	Q6E0U4-6
	DMKN	NM_001126057.3		c.837_860delCGGCAGCAGTGGCGGCAGCAGTGG	p.Gly280_Gly287del	disruptive_inframe_deletion	Exon 5 of 11	NP_001119529.2	Q6E0U4-5

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DMKN	ENST00000339686.8	TSL:1 MANE Select	c.837_860delCGGCAGCAGTGGCGGCAGCAGTGG	p.Gly280_Gly287del	disruptive_inframe_deletion	Exon 5 of 16	ENSP00000342012.3	Q6E0U4-1
	DMKN	ENST00000447113.6	TSL:1	c.837_860delCGGCAGCAGTGGCGGCAGCAGTGG	p.Gly280_Gly287del	disruptive_inframe_deletion	Exon 5 of 13	ENSP00000394908.2	Q6E0U4-6
	DMKN	ENST00000424570.6	TSL:1	c.837_860delCGGCAGCAGTGGCGGCAGCAGTGG	p.Gly280_Gly287del	disruptive_inframe_deletion	Exon 5 of 11	ENSP00000388404.2	Q6E0U4-5

Frequencies

GnomAD3 genomes AF: 0.0156 AC: 1311 AN: 84140 Hom.: 14 Cov.: 22

Gnomad AFR AF: 0.0689

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00739

Gnomad ASJ AF: 0.0115

Gnomad EAS AF: 0.00106

Gnomad SAS AF: 0.00310

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.0337

Gnomad NFE AF: 0.00135

Gnomad OTH AF: 0.0103

GnomAD4 exome AF: 0.00265 AC: 2676 AN: 1011714 Hom.: 18 AF XY: 0.00252 AC XY: 1258 AN XY: 500112

African (AFR) AF: 0.0492 AC: 983 AN: 19972

American (AMR) AF: 0.00865 AC: 153 AN: 17690

Ashkenazi Jewish (ASJ) AF: 0.0111 AC: 194 AN: 17456

East Asian (EAS) AF: 0.00299 AC: 47 AN: 15708

South Asian (SAS) AF: 0.00155 AC: 79 AN: 50838

European-Finnish (FIN) AF: 0.0000643 AC: 2 AN: 31086

Middle Eastern (MID) AF: 0.0156 AC: 45 AN: 2884

European-Non Finnish (NFE) AF: 0.00119 AC: 968 AN: 815346

Other (OTH) AF: 0.00503 AC: 205 AN: 40734

GnomAD4 genome AF: 0.0156 AC: 1317 AN: 84158 Hom.: 14 Cov.: 22 AF XY: 0.0152 AC XY: 623 AN XY: 40924

African (AFR) AF: 0.0691 AC: 1148 AN: 16620

American (AMR) AF: 0.00739 AC: 53 AN: 7174

Ashkenazi Jewish (ASJ) AF: 0.0115 AC: 26 AN: 2256

East Asian (EAS) AF: 0.00107 AC: 2 AN: 1874

South Asian (SAS) AF: 0.00312 AC: 8 AN: 2568

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 6556

Middle Eastern (MID) AF: 0.0361 AC: 7 AN: 194

European-Non Finnish (NFE) AF: 0.00135 AC: 61 AN: 45048

Other (OTH) AF: 0.0101 AC: 12 AN: 1190

Alfa AF: 0.00 Hom.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.5
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs760401945; hg19: chr19-36002370;