chr19-38565560-GCGAGGGCGCTGGAGACGCCG-G
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_000540.3(RYR1):c.13229_13248delAGGGCGCTGGAGACGCCGCG(p.Glu4410GlyfsTer166) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. E4410E) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay. The gene RYR1 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000540.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- malignant hyperthermia, susceptibility to, 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, Genomics England PanelApp, Ambry Genetics, ClinGen
- RYR1-related myopathyInheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, PanelApp Australia
- congenital multicore myopathy with external ophthalmoplegiaInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
- central core myopathyInheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- King-Denborough syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- malignant hyperthermia of anesthesiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- autosomal recessive centronuclear myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- benign Samaritan congenital myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- congenital myopathy with myasthenic-like onsetInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- lethal multiple pterygium syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000540.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RYR1 | MANE Select | c.13229_13248delAGGGCGCTGGAGACGCCGCG | p.Glu4410GlyfsTer166 | frameshift | Exon 91 of 106 | NP_000531.2 | P21817-1 | ||
| RYR1 | c.13214_13233delAGGGCGCTGGAGACGCCGCG | p.Glu4405GlyfsTer166 | frameshift | Exon 90 of 105 | NP_001036188.1 | P21817-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RYR1 | TSL:5 MANE Select | c.13229_13248delAGGGCGCTGGAGACGCCGCG | p.Glu4410GlyfsTer166 | frameshift | Exon 91 of 106 | ENSP00000352608.2 | P21817-1 | ||
| RYR1 | TSL:1 | c.13214_13233delAGGGCGCTGGAGACGCCGCG | p.Glu4405GlyfsTer166 | frameshift | Exon 90 of 105 | ENSP00000347667.3 | P21817-2 | ||
| RYR1 | TSL:1 | n.*3939_*3958delAGGGCGCTGGAGACGCCGCG | non_coding_transcript_exon | Exon 88 of 103 | ENSP00000470927.2 | M0R014 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.