chr19-43507763-TAGACCCAGGAGTCCAGGCCCCCAGCCTCTCCTCCCTC-T

Position:

• chr19-43507763-TAGACCCAGGAGTCCAGGCCCCCAGCCTCTCCTCCCTC-T

Variant summary

Our verdict is Benign. Variant got -10 ACMG points: 0P and 10B. BP6_Moderate BA1

The ENST00000600651(ETHE1):​c.*73_*109delGAGGGAGGAGAGGCTGGGGGCCTGGACTCCTGGGTCT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0385 in 299,138 control chromosomes in the GnomAD database, including 239 homozygotes. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.074 (94 hom., cov: 15)
  • Exomes 𝑓: 0.031 (145 hom.)
• Consequence: ETHE1 ENST00000600651 3_prime_UTR
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.00

Genes affected

ETHE1 (HGNC:23287): (ETHE1 persulfide dioxygenase) This gene encodes a member of the metallo beta-lactamase family of iron-containing proteins involved in the mitochondrial sulfide oxidation pathway. The encoded protein catalyzes the oxidation of a persulfide substrate to sulfite. Certain mutations in this gene cause ethylmalonic encephalopathy, an infantile metabolic disorder affecting the brain, gastrointestinal tract and peripheral vessels. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]

ACMG classification

Verdict is Benign. Variant got -10 ACMG points.

• BP6: Variant 19-43507763-TAGACCCAGGAGTCCAGGCCCCCAGCCTCTCCTCCCTC-T is Benign according to our data. Variant chr19-43507763-TAGACCCAGGAGTCCAGGCCCCCAGCCTCTCCTCCCTC-T is described in ClinVar as [Benign]. Clinvar id is 1248611.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (NFE) allele frequency at 95% confidence interval = 0.0732 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ETHE1	NM_014297.5	c.712+144_712+180delGAGGGAGGAGAGGCTGGGGGCCTGGACTCCTGGGTCT		intron_variant		ENST00000292147.7	NP_055112.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ETHE1	ENST00000292147.7	c.712+144_712+180delGAGGGAGGAGAGGCTGGGGGCCTGGACTCCTGGGTCT		intron_variant		1	NM_014297.5	ENSP00000292147.1

Frequencies

GnomAD3 genomes AF: 0.0741 AC: 3769 AN: 50866 Hom.: 94 Cov.: 15

Gnomad AFR AF: 0.0737

Gnomad AMI AF: 0.0680

Gnomad AMR AF: 0.0702

Gnomad ASJ AF: 0.0845

Gnomad EAS AF: 0.0729

Gnomad SAS AF: 0.0722

Gnomad FIN AF: 0.0514

Gnomad MID AF: 0.0968

Gnomad NFE AF: 0.0759

Gnomad OTH AF: 0.0759

GnomAD4 exome AF: 0.0312 AC: 7739 AN: 248256 Hom.: 145 AF XY: 0.0308 AC XY: 4179 AN XY: 135844

Gnomad4 AFR exome AF: 0.0335

Gnomad4 AMR exome AF: 0.0462

Gnomad4 ASJ exome AF: 0.0309

Gnomad4 EAS exome AF: 0.0304

Gnomad4 SAS exome AF: 0.0244

Gnomad4 FIN exome AF: 0.0326

Gnomad4 NFE exome AF: 0.0314

Gnomad4 OTH exome AF: 0.0304

GnomAD4 genome AF: 0.0741 AC: 3769 AN: 50882 Hom.: 94 Cov.: 15 AF XY: 0.0736 AC XY: 1751 AN XY: 23786

Gnomad4 AFR AF: 0.0737

Gnomad4 AMR AF: 0.0698

Gnomad4 ASJ AF: 0.0845

Gnomad4 EAS AF: 0.0730

Gnomad4 SAS AF: 0.0719

Gnomad4 FIN AF: 0.0514

Gnomad4 NFE AF: 0.0759

Gnomad4 OTH AF: 0.0754

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Benign, criteria provided, single submitter

clinical testing

GeneDx

Jun 26, 2018

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1568490995; hg19: chr19-44011915;