chr19-49812986-AAGGCCCCACCTGCTGACGGGCGG-A

Variant names:

• chr19-49812986-AAGGCCCCACCTGCTGACGGGCGG-A
• rs548706733
• NM_025129.5:c.98_111+9delCCGCCCGTCAGCAGGTGGGGCCT

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5

The NM_025129.5(FUZ):​c.98_111+9delCCGCCCGTCAGCAGGTGGGGCCT​(p.Ala34fs) variant causes a frameshift, splice donor, splice region, intron change. The variant allele was found at a frequency of 0.0000155 in 1,549,496 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (no stars).

• Frequency:
  • Genomes: 𝑓 0.000092 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0000072 (0 hom.)
• Consequence: FUZ NM_025129.5 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic no assertion criteria provided P:2
• Conservation: PhyloP100: 4.93
• Publications: 2 publications found

Genes affected

FUZ (HGNC:26219): (fuzzy planar cell polarity protein) This gene encodes a planar cell polarity protein that is involved in ciliogenesis and directional cell movement. Knockout studies in mice exhibit neural tube defects and defective cilia, and mutations in this gene are associated with neural tube defects in humans. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2012]

FUZ Gene-Disease associations (from GenCC):

• neural tube defects, susceptibility to

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PP5: Variant 19-49812986-AAGGCCCCACCTGCTGACGGGCGG-A is Pathogenic according to our data. Variant chr19-49812986-AAGGCCCCACCTGCTGACGGGCGG-A is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 446675.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_025129.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FUZ	NM_025129.5	MANE Select	c.98_111+9delCCGCCCGTCAGCAGGTGGGGCCT	p.Ala34fs	frameshift splice_donor splice_region intron	Exon 1 of 11	NP_079405.2
	FUZ	NM_001352262.2		c.98_111+9delCCGCCCGTCAGCAGGTGGGGCCT	p.Ala34fs	frameshift splice_donor splice_region intron	Exon 1 of 11	NP_001339191.1
	FUZ	NM_001171937.2		c.98_111+9delCCGCCCGTCAGCAGGTGGGGCCT	p.Ala34fs	frameshift splice_donor splice_region intron	Exon 1 of 10	NP_001165408.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FUZ	ENST00000313777.9	TSL:1 MANE Select	c.98_111+9delCCGCCCGTCAGCAGGTGGGGCCT	p.Ala34fs	frameshift splice_donor splice_region intron	Exon 1 of 11	ENSP00000313309.4
	FUZ	ENST00000531017.5	TSL:1	n.301_314+9delCCGCCCGTCAGCAGGTGGGGCCT		splice_donor splice_region intron non_coding_transcript_exon	Exon 1 of 5
	FUZ	ENST00000528094.5	TSL:2	c.98_111+9delCCGCCCGTCAGCAGGTGGGGCCT	p.Ala34fs	frameshift splice_donor splice_region intron	Exon 1 of 10	ENSP00000435177.1

Frequencies

GnomAD3 genomes AF: 0.0000920 AC: 14 AN: 152250 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.000338

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000666 AC: 1 AN: 150106 AF XY: 0.00

Gnomad AFR exome AF: 0.000138

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000716 AC: 10 AN: 1397128 Hom.: 0 AF XY: 0.00000871 AC XY: 6 AN XY: 689204

African (AFR) AF: 0.000285 AC: 9 AN: 31562

American (AMR) AF: 0.00 AC: 0 AN: 35698

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25174

East Asian (EAS) AF: 0.00 AC: 0 AN: 35726

South Asian (SAS) AF: 0.00 AC: 0 AN: 79200

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 48658

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5690

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1077484

Other (OTH) AF: 0.0000173 AC: 1 AN: 57936

GnomAD4 genome AF: 0.0000919 AC: 14 AN: 152368 Hom.: 0 Cov.: 33 AF XY: 0.000107 AC XY: 8 AN XY: 74506

African (AFR) AF: 0.000337 AC: 14 AN: 41596

American (AMR) AF: 0.00 AC: 0 AN: 15308

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5184

South Asian (SAS) AF: 0.00 AC: 0 AN: 4834

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10620

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68038

Other (OTH) AF: 0.00 AC: 0 AN: 2112

Alfa AF: 0.000214 Hom.: 0

Bravo AF: 0.000166

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic/Likely pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
2	-	-	Short-rib thoracic dysplasia 6 with or without polydactyly (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.9
Mutation Taster		=5/195	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs548706733; hg19: chr19-50316243;