chr19-8510850-CCCGCGGGGGCGTCGGGGCGCGGCGGCCCGGCCGCGGGGG-C

Position:

• chr19-8510850-CCCGCGGGGGCGTCGGGGCGCGGCGGCCCGGCCGCGGGGG-C

Variant summary

Our verdict is Benign. Variant got -7 ACMG points: 0P and 7B. BP3 BP6_Moderate BS2

The NM_001146175.2(ZNF414):​c.1061_1099delCCCCCGCGGCCGGGCCGCCGCGCCCCGACGCCCCCGCGG​(p.Ala354_Ala366del) variant causes a disruptive inframe deletion, splice region change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00541 in 1,223,572 control chromosomes in the GnomAD database, including 134 homozygotes. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.0027 (3 hom., cov: 31)
  • Exomes 𝑓: 0.0058 (131 hom.)
• Consequence: ZNF414 NM_001146175.2 disruptive_inframe_deletion, splice_region
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 2.20

Genes affected

ZNF414 (HGNC:20630): (zinc finger protein 414) Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be located in nucleus. Predicted to be part of chromatin. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Benign. Variant got -7 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001146175.2
• BP6: Variant 19-8510850-CCCGCGGGGGCGTCGGGGCGCGGCGGCCCGGCCGCGGGGG-C is Benign according to our data. Variant chr19-8510850-CCCGCGGGGGCGTCGGGGCGCGGCGGCCCGGCCGCGGGGG-C is described in ClinVar as [Likely_benign]. Clinvar id is 2649202.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High Homozygotes in GnomAd4 at 3 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ZNF414	NM_001146175.2	c.1061_1099delCCCCCGCGGCCGGGCCGCCGCGCCCCGACGCCCCCGCGG	p.Ala354_Ala366del	disruptive_inframe_deletion, splice_region_variant	7/8	ENST00000393927.9	NP_001139647.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ZNF414	ENST00000393927.9	c.1061_1099delCCCCCGCGGCCGGGCCGCCGCGCCCCGACGCCCCCGCGG	p.Ala354_Ala366del	disruptive_inframe_deletion, splice_region_variant	7/8	1	NM_001146175.2	ENSP00000377504.3
ZNF414	ENST00000596772.5	c.269_307delCCCCCGCGGCCGGGCCGCCGCGCCCCGACGCCCCCGCGG	p.Ala90_Ala102del	disruptive_inframe_deletion	3/3	2		ENSP00000471378.1

Frequencies

GnomAD3 genomes AF: 0.00267 AC: 397 AN: 148958 Hom.: 3 Cov.: 31

Gnomad AFR AF: 0.000755

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000401

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000194

Gnomad SAS AF: 0.000621

Gnomad FIN AF: 0.00926

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00400

Gnomad OTH AF: 0.000974

GnomAD3 exomes AF: 0.00871 AC: 294 AN: 33768 Hom.: 28 AF XY: 0.00788 AC XY: 160 AN XY: 20306

Gnomad AFR exome AF: 0.00463

Gnomad AMR exome AF: 0.00627

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00922

Gnomad SAS exome AF: 0.00145

Gnomad FIN exome AF: 0.0121

Gnomad NFE exome AF: 0.0118

Gnomad OTH exome AF: 0.00843

GnomAD4 exome AF: 0.00579 AC: 6225 AN: 1074506 Hom.: 131 AF XY: 0.00576 AC XY: 2963 AN XY: 514130

Gnomad4 AFR exome AF: 0.000955

Gnomad4 AMR exome AF: 0.00243

Gnomad4 ASJ exome AF: 0.000371

Gnomad4 EAS exome AF: 0.000527

Gnomad4 SAS exome AF: 0.00203

Gnomad4 FIN exome AF: 0.0101

Gnomad4 NFE exome AF: 0.00623

Gnomad4 OTH exome AF: 0.00373

GnomAD4 genome AF: 0.00266 AC: 397 AN: 149066 Hom.: 3 Cov.: 31 AF XY: 0.00291 AC XY: 212 AN XY: 72772

Gnomad4 AFR AF: 0.000753

Gnomad4 AMR AF: 0.000400

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000195

Gnomad4 SAS AF: 0.000622

Gnomad4 FIN AF: 0.00926

Gnomad4 NFE AF: 0.00400

Gnomad4 OTH AF: 0.000963

Alfa AF: 0.00276 Hom.: 0

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Likely benign, criteria provided, single submitter

clinical testing

CeGaT Center for Human Genetics Tuebingen

Dec 01, 2022

ZNF414: BS2 -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs768916342; hg19: chr19-8575734;