chr2-118846529-CGCCGCCGCCGCCACTGCCGCCGCG-C

Variant names:

• chr2-118846529-CGCCGCCGCCGCCACTGCCGCCGCG-C
• rs758084818
• NM_001426.4:c.615_638delCGCGGCGGCAGTGGCGGCGGCGGC

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP3 BP6 BS1 BS2

The NM_001426.4(EN1):​c.615_638delCGCGGCGGCAGTGGCGGCGGCGGC​(p.Ala206_Ala213del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00165 in 1,219,408 control chromosomes in the GnomAD database, including 35 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (no stars).

• Frequency:
  • Genomes: 𝑓 0.0080 (9 hom., cov: 32)
  • Exomes 𝑓: 0.00077 (26 hom.)
• Consequence: EN1 NM_001426.4 disruptive_inframe_deletion
• Clinical Significance: Likely benign no assertion criteria provided B:1
• Conservation: PhyloP100: 1.33
• Publications: 0 publications found

Genes affected

EN1 (HGNC:3342): (engrailed homeobox 1) Homeobox-containing genes are thought to have a role in controlling development. In Drosophila, the 'engrailed' (en) gene plays an important role during development in segmentation, where it is required for the formation of posterior compartments. Different mutations in the mouse homologs, En1 and En2, produced different developmental defects that frequently are lethal. The human engrailed homologs 1 and 2 encode homeodomain-containing proteins and have been implicated in the control of pattern formation during development of the central nervous system. [provided by RefSeq, Jul 2008]

EN1 Gene-Disease associations (from GenCC):

• ENDOVE syndrome, limb-only type

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001426.4
• BP6: Variant 2-118846529-CGCCGCCGCCGCCACTGCCGCCGCG-C is Benign according to our data. Variant chr2-118846529-CGCCGCCGCCGCCACTGCCGCCGCG-C is described in ClinVar as Likely_benign. ClinVar VariationId is 3050668.Status of the report is no_assertion_criteria_provided, 0 stars.
• BS1: Variant frequency is greater than expected in population afr. GnomAd4 allele frequency = 0.00796 (1179/148122) while in subpopulation AFR AF = 0.0263 (1080/40992). AF 95% confidence interval is 0.025. There are 9 homozygotes in GnomAd4. There are 553 alleles in the male GnomAd4 subpopulation. Median coverage is 32. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 9 Unknown gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001426.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EN1	NM_001426.4	MANE Select	c.615_638delCGCGGCGGCAGTGGCGGCGGCGGC	p.Ala206_Ala213del	disruptive_inframe_deletion	Exon 1 of 2	NP_001417.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EN1	ENST00000295206.7	TSL:2 MANE Select	c.615_638delCGCGGCGGCAGTGGCGGCGGCGGC	p.Ala206_Ala213del	disruptive_inframe_deletion	Exon 1 of 2	ENSP00000295206.5	Q05925

Frequencies

GnomAD3 genomes AF: 0.00798 AC: 1181 AN: 148014 Hom.: 9 Cov.: 32

Gnomad AFR AF: 0.0265

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00469

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000415

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00323

Gnomad NFE AF: 0.000166

Gnomad OTH AF: 0.00737

GnomAD2 exomes AF: 0.000480 AC: 9 AN: 18764 AF XY: 0.000253

Gnomad AFR exome AF: 0.0260

Gnomad AMR exome AF: 0.00236

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00185

GnomAD4 exome AF: 0.000774 AC: 829 AN: 1071286 Hom.: 26 AF XY: 0.000688 AC XY: 352 AN XY: 511834

African (AFR) AF: 0.0277 AC: 608 AN: 21942

American (AMR) AF: 0.00273 AC: 24 AN: 8776

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 13504

East Asian (EAS) AF: 0.000127 AC: 3 AN: 23608

South Asian (SAS) AF: 0.0000853 AC: 2 AN: 23450

European-Finnish (FIN) AF: 0.0000814 AC: 2 AN: 24578

Middle Eastern (MID) AF: 0.00131 AC: 4 AN: 3042

European-Non Finnish (NFE) AF: 0.0000956 AC: 87 AN: 910406

Other (OTH) AF: 0.00236 AC: 99 AN: 41980

GnomAD4 genome AF: 0.00796 AC: 1179 AN: 148122 Hom.: 9 Cov.: 32 AF XY: 0.00766 AC XY: 553 AN XY: 72206

African (AFR) AF: 0.0263 AC: 1080 AN: 40992

American (AMR) AF: 0.00468 AC: 70 AN: 14952

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3348

East Asian (EAS) AF: 0.00 AC: 0 AN: 5100

South Asian (SAS) AF: 0.000415 AC: 2 AN: 4814

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9328

Middle Eastern (MID) AF: 0.00350 AC: 1 AN: 286

European-Non Finnish (NFE) AF: 0.000166 AC: 11 AN: 66334

Other (OTH) AF: 0.00730 AC: 15 AN: 2056

Alfa AF: 0.00577 Hom.: 0

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	-	1	EN1-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.3
Mutation Taster		=186/14	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs758084818; hg19: chr2-119604105;