chr2-148021483-GCTGCTGCTGCTGCTACTGCTGCTGCTGCTA-G

Variant names:

• chr2-148021483-GCTGCTGCTGCTGCTACTGCTGCTGCTGCTA-G
• rs755361381
• NM_001378120.1:c.-1114_-1085delGCTACTGCTGCTGCTGCTACTGCTGCTGCT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001378120.1(MBD5):​c.-1114_-1085delGCTACTGCTGCTGCTGCTACTGCTGCTGCT variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000483 in 414,108 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 29)
  • Exomes 𝑓: 0.0000048 (0 hom.)
• Consequence: MBD5 NM_001378120.1 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.96
• Publications: 0 publications found

Genes affected

MBD5 (HGNC:20444): (methyl-CpG binding domain protein 5) This gene encodes a member of the methyl-CpG-binding domain (MBD) family. The MBD consists of about 70 residues and is the minimal region required for a methyl-CpG-binding protein binding specifically to methylated DNA. In addition to the MBD domain, this protein contains a PWWP domain (Pro-Trp-Trp-Pro motif), which consists of 100-150 amino acids and is found in numerous proteins that are involved in cell division, growth and differentiation. Mutations in this gene cause an autosomal dominant type of cognitive disability. The encoded protein interacts with the polycomb repressive complex PR-DUB which catalyzes the deubiquitination of a lysine residue of histone 2A. Haploinsufficiency of this gene is associated with a syndrome involving microcephaly, intellectual disabilities, severe speech impairment, and seizures. Alternatively spliced transcript variants have been found, but their full-length nature is not determined. [provided by RefSeq, Jul 2017]

ORC4 (HGNC:8490): (origin recognition complex subunit 4) The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. This gene encodes a subunit of the ORC complex. Several alternatively spliced transcript variants, some of which encode the same protein, have been reported for this gene. [provided by RefSeq, Oct 2010]

ORC4 Gene-Disease associations (from GenCC):

• Meier-Gorlin syndrome 2

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, G2P
• Meier-Gorlin syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MBD5	NM_001378120.1	c.-1114_-1085delGCTACTGCTGCTGCTGCTACTGCTGCTGCT		5_prime_UTR_variant	Exon 1 of 14	ENST00000642680.2	NP_001365049.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MBD5	ENST00000642680.2	c.-1114_-1085delGCTACTGCTGCTGCTGCTACTGCTGCTGCT		5_prime_UTR_variant	Exon 1 of 14		NM_001378120.1	ENSP00000493871.2

Frequencies

GnomAD3 genomes Cov.: 29

GnomAD4 exome AF: 0.00000483 AC: 2 AN: 414108 Hom.: 0 AF XY: 0.00000873 AC XY: 2 AN XY: 229146

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 11190

American (AMR) AF: 0.00 AC: 0 AN: 30694

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 14210

East Asian (EAS) AF: 0.00 AC: 0 AN: 16564

South Asian (SAS) AF: 0.00 AC: 0 AN: 60974

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 32532

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 1938

European-Non Finnish (NFE) AF: 0.00000888 AC: 2 AN: 225112

Other (OTH) AF: 0.00 AC: 0 AN: 20894

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 29

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs755361381; hg19: chr2-148779052;