chr2-178619715-ATGTATCTTTCCTTCACTCATCATCTGGTGTTTATCACCCTGGACAACAACCATGTTATTTCTTAGCCATTGGACTTCCACC-A

Variant names:

• chr2-178619715-ATGTATCTTTCCTTCACTCATCATCTGGTGTTTATCACCCTGGACAACAACCATGTTATTTCTTAGCCATTGGACTTCCACC-A
• rs1553713878
• NM_001267550.2:c.46521_46601delGGTGGAAGTCCAATGGCTAAGAAATAACATGGTTGTTGTCCAGGGTGATAAACACCAGATGATGAGTGAAGGAAAGATACA

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP3

The NM_001267550.2(TTN):​c.46521_46601delGGTGGAAGTCCAATGGCTAAGAAATAACATGGTTGTTGTCCAGGGTGATAAACACCAGATGATGAGTGAAGGAAAGATACA​(p.Lys15507_His15534delinsAsn) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000205 in 1,460,446 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: TTN NM_001267550.2 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 9.86
• Publications: 0 publications found

Genes affected

TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]

TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001267550.2.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TTN	NM_001267550.2	c.46521_46601delGGTGGAAGTCCAATGGCTAAGAAATAACATGGTTGTTGTCCAGGGTGATAAACACCAGATGATGAGTGAAGGAAAGATACA	p.Lys15507_His15534delinsAsn	disruptive_inframe_deletion	Exon 250 of 363	ENST00000589042.5	NP_001254479.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TTN	ENST00000589042.5	c.46521_46601delGGTGGAAGTCCAATGGCTAAGAAATAACATGGTTGTTGTCCAGGGTGATAAACACCAGATGATGAGTGAAGGAAAGATACA	p.Lys15507_His15534delinsAsn	disruptive_inframe_deletion	Exon 250 of 363	5	NM_001267550.2	ENSP00000467141.1

Frequencies

GnomAD3 genomes AF: 0.00000659 AC: 1 AN: 151806 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000205 AC: 3 AN: 1460446 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 726522

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33390

American (AMR) AF: 0.00 AC: 0 AN: 44666

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26074

East Asian (EAS) AF: 0.00 AC: 0 AN: 39624

South Asian (SAS) AF: 0.00 AC: 0 AN: 86194

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53388

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5754

European-Non Finnish (NFE) AF: 0.00000270 AC: 3 AN: 1111054

Other (OTH) AF: 0.00 AC: 0 AN: 60302

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.00000000359607), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000659 AC: 1 AN: 151806 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74108

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 41396

American (AMR) AF: 0.00 AC: 0 AN: 15200

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3460

East Asian (EAS) AF: 0.00 AC: 0 AN: 5124

South Asian (SAS) AF: 0.00 AC: 0 AN: 4830

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10616

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 67868

Other (OTH) AF: 0.00 AC: 0 AN: 2084

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Uncertain:1

Sep 10, 2012

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant classified as Uncertain Significance - Favor Pathogenic. The Lys12939_Hi s12966delinsAsn variant in TTN has not been reported in the literature nor previ ously identified by our laboratory. This variant deletes 28 amino acid residues from lysine (Lys) at position 12939 to histidine (His) at position 12966 and ins erts an asparagine (Asn), but does not alter the protein reading frame. While th is variant results in the loss of a section of the protein, it is unclear how th is variant may impact the protein. Additional studies are needed to fully assess the clinical significance of this variant. -

Cardiovascular phenotype Uncertain:1

Feb 02, 2021

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.19326_19406del81 variant (also known as p.K6442_H6469delinsN), located in coding exon 77 of the TTN gene, results from an in-frame deletion of 81 nucleotides at nucleotide positions 19326 to 19406. This results in an in-frame deletion of 28 amino acids and insertion of an asparagine residue. This amino acid region is well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.9
Mutation Taster		=40/160	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553713878; hg19: chr2-179484442;