chr2-210477693-ATAGTTGCTTTCTTAGGAAATG-A

Variant names:

• chr2-210477693-ATAGTTGCTTTCTTAGGAAATG-A
• ENST00000430249:c.-56_-36delGGAAATGTAGTTGCTTTCTTA

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_001122633.3(CPS1):​c.-74_-54delGGAAATGTAGTTGCTTTCTTA variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000276 in 1,448,334 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000028 (0 hom.)
• Consequence: CPS1 NM_001122633.3 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.52

Genes affected

CPS1 (HGNC:2323): (carbamoyl-phosphate synthase 1) The mitochondrial enzyme encoded by this gene catalyzes synthesis of carbamoyl phosphate from ammonia and bicarbonate. This reaction is the first committed step of the urea cycle, which is important in the removal of excess urea from cells. The encoded protein may also represent a core mitochondrial nucleoid protein. Three transcript variants encoding different isoforms have been found for this gene. The shortest isoform may not be localized to the mitochondrion. Mutations in this gene have been associated with carbamoyl phosphate synthetase deficiency, susceptibility to persistent pulmonary hypertension, and susceptibility to venoocclusive disease after bone marrow transplantation.[provided by RefSeq, May 2010]

LANCL1 (HGNC:6508): (LanC like glutathione S-transferase 1) This gene encodes a loosely associated peripheral membrane protein related to the LanC family of bacterial membrane-associated proteins involved in the biosynthesis of antimicrobial peptides. This protein may play a role as a peptide-modifying enzyme component in eukaryotic cells. Previously considered a member of the G-protein-coupled receptor superfamily, this protein is now in the LanC family. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CPS1	NM_001122633.3	c.-74_-54delGGAAATGTAGTTGCTTTCTTA		5_prime_UTR_variant	Exon 1 of 39		NP_001116105.2
CPS1	NM_001369257.1	c.-194_-174delGGAAATGTAGTTGCTTTCTTA		5_prime_UTR_variant	Exon 1 of 40		NP_001356186.1
LANCL1	XM_005246243.3	c.-245_-225delCATTTCCTAAGAAAGCAACTA		upstream_gene_variant			XP_005246300.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CPS1	ENST00000430249	c.-56_-36delGGAAATGTAGTTGCTTTCTTA		5_prime_UTR_variant	Exon 1 of 39	1		ENSP00000402608.2
CPS1	ENST00000673510	c.-194_-174delGGAAATGTAGTTGCTTTCTTA		5_prime_UTR_variant	Exon 1 of 40			ENSP00000500537.1
CPS1	ENST00000673630	c.-308_-288delGGAAATGTAGTTGCTTTCTTA		5_prime_UTR_variant	Exon 1 of 40			ENSP00000501073.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000276 AC: 4 AN: 1448334 Hom.: 0 AF XY: 0.00000417 AC XY: 3 AN XY: 719884

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000362

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr2-211342417;