chr2-240594824-A-AGATGATTCTGTCCCAGGAGCCGGGAGGAGGGT

Position:

• chr2-240594824-A-AGATGATTCTGTCCCAGGAGCCGGGAGGAGGGT

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BA1

The NM_023083.4(CAPN10):​c.997+136_998-148dupCGGGAGGAGGGTGATGATTCTGTCCCAGGAGC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.395 in 791,422 control chromosomes in the GnomAD database, including 89,362 homozygotes. Variant has been reported in ClinVar as risk factor (no stars).

• Frequency:
  • Genomes: 𝑓 0.49 (18630 hom., cov: 37)
  • Exomes 𝑓: 0.37 (70732 hom.)
• Consequence: CAPN10 NM_023083.4 intron
• Clinical Significance: risk factor no assertion criteria provided O:1
• Conservation: PhyloP100: -0.0430

Genes affected

CAPN10 (HGNC:1477): (calpain 10) Calpains represent a ubiquitous, well-conserved family of calcium-dependent cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large catalytic subunit has four domains: domain I, the N-terminal regulatory domain that is processed upon calpain activation; domain II, the protease domain; domain III, a linker domain of unknown function; and domain IV, the calmodulin-like calcium-binding domain. This gene encodes a large subunit. It is an atypical calpain in that it lacks the calmodulin-like calcium-binding domain and instead has a divergent C-terminal domain. It is similar in organization to calpains 5 and 6. This gene is associated with type 2 or non-insulin-dependent diabetes mellitus (NIDDM), and is located within the NIDDM1 region. Multiple alternative transcript variants have been described for this gene. [provided by RefSeq, Sep 2010]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.604 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CAPN10	NM_023083.4	c.997+136_998-148dupCGGGAGGAGGGTGATGATTCTGTCCCAGGAGC		intron_variant		ENST00000391984.7	NP_075571.2
CAPN10	NM_023085.4	c.997+136_998-148dupCGGGAGGAGGGTGATGATTCTGTCCCAGGAGC		intron_variant			NP_075573.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CAPN10	ENST00000391984.7	c.997+115_997+116insGATGATTCTGTCCCAGGAGCCGGGAGGAGGGT		intron_variant		1	NM_023083.4	ENSP00000375844.2

Frequencies

GnomAD3 genomes AF: 0.492 AC: 66138 AN: 134404 Hom.: 18616 Cov.: 37

Gnomad AFR AF: 0.277

Gnomad AMI AF: 0.698

Gnomad AMR AF: 0.553

Gnomad ASJ AF: 0.598

Gnomad EAS AF: 0.623

Gnomad SAS AF: 0.511

Gnomad FIN AF: 0.499

Gnomad MID AF: 0.518

Gnomad NFE AF: 0.588

Gnomad OTH AF: 0.514

GnomAD4 exome AF: 0.375 AC: 246097 AN: 656900 Hom.: 70732 AF XY: 0.386 AC XY: 129400 AN XY: 335262

Gnomad4 AFR exome AF: 0.177

Gnomad4 AMR exome AF: 0.460

Gnomad4 ASJ exome AF: 0.516

Gnomad4 EAS exome AF: 0.576

Gnomad4 SAS exome AF: 0.450

Gnomad4 FIN exome AF: 0.467

Gnomad4 NFE exome AF: 0.340

Gnomad4 OTH exome AF: 0.437

GnomAD4 genome AF: 0.492 AC: 66183 AN: 134522 Hom.: 18630 Cov.: 37 AF XY: 0.488 AC XY: 31591 AN XY: 64722

Gnomad4 AFR AF: 0.277

Gnomad4 AMR AF: 0.553

Gnomad4 ASJ AF: 0.598

Gnomad4 EAS AF: 0.623

Gnomad4 SAS AF: 0.513

Gnomad4 FIN AF: 0.499

Gnomad4 NFE AF: 0.588

Gnomad4 OTH AF: 0.517

ClinVar

Significance: risk factor

Submissions summary: Other:1

Revision: no assertion criteria provided

Submissions by phenotype

Type 2 diabetes mellitus 1, susceptibility to Other:1

risk factor, no assertion criteria provided

literature only

OMIM

Jul 01, 2002

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3842570; hg19: chr2-241534241;