chr2-240869043-G-GTCACTCGGGGGGCCTGGGTCTCACCCATGTTCCCACCCACAGATCGTGGACGAGGGAAGGGGGTCACTGCCTCC

Variant names:

• chr2-240869043-G-GTCACTCGGGGGGCCTGGGTCTCACCCATGTTCCCACCCACAGATCGTGGACGAGGGAAGGGGGTCACTGCCTCC
• rs180177174
• NM_000030.3:c.165+19_166-48dupCGGGGGGCCTGGGTCTCACCCATGTTCCCACCCACAGATCGTGGACGAGGGAAGGGGGTCACTGCCTCCTCACT

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The NM_000030.3(AGXT):​c.165+19_166-48dupCGGGGGGCCTGGGTCTCACCCATGTTCCCACCCACAGATCGTGGACGAGGGAAGGGGGTCACTGCCTCCTCACT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency: Genomes: not found (cov: 34)
• Consequence: AGXT NM_000030.3 intron
• Clinical Significance: Likely benign criteria provided, single submitter U:1 B:1
• Conservation: PhyloP100: -1.53
• Publications: 2 publications found

Genes affected

AGXT (HGNC:341): (alanine--glyoxylate aminotransferase) This gene is expressed only in the liver and the encoded protein is localized mostly in the peroxisomes, where it is involved in glyoxylate detoxification. Mutations in this gene, some of which alter subcellular targetting, have been associated with type I primary hyperoxaluria. [provided by RefSeq, Jul 2008]

AGXT Gene-Disease associations (from GenCC):

• alanine glyoxylate aminotransferase deficiency

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• primary hyperoxaluria type 1

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Myriad Women’s Health, Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet

ENSG00000297735 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP6: Variant 2-240869043-G-GTCACTCGGGGGGCCTGGGTCTCACCCATGTTCCCACCCACAGATCGTGGACGAGGGAAGGGGGTCACTGCCTCC is Benign according to our data. Variant chr2-240869043-G-GTCACTCGGGGGGCCTGGGTCTCACCCATGTTCCCACCCACAGATCGTGGACGAGGGAAGGGGGTCACTGCCTCC is described in ClinVar as Likely_benign. ClinVar VariationId is 204024.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AGXT	NM_000030.3	c.165+19_166-48dupCGGGGGGCCTGGGTCTCACCCATGTTCCCACCCACAGATCGTGGACGAGGGAAGGGGGTCACTGCCTCCTCACT		intron_variant	Intron 1 of 10	ENST00000307503.4	NP_000021.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AGXT	ENST00000307503.4	c.165+13_165+14insTCACTCGGGGGGCCTGGGTCTCACCCATGTTCCCACCCACAGATCGTGGACGAGGGAAGGGGGTCACTGCCTCC		intron_variant	Intron 1 of 10	1	NM_000030.3	ENSP00000302620.3

Frequencies

GnomAD3 genomes Cov.: 34

GnomAD4 exome Cov.: 34

GnomAD4 genome Cov.: 34

ClinVar

Significance: Likely benign

Submissions summary: Uncertain:1 Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

Primary hyperoxaluria, type I Uncertain:1

Nov 27, 2014

Clinical Biochemistry Laboratory, Health Services Laboratory

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: research

- -

not provided Benign:1

Jul 11, 2017

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: The AGXT c.165+19_165+92dup74 variant involves the duplication of 74 nucleotides in the first intron of the AGXT gene. 5/5 splice prediction tools predict no significant impact on the splice donor site. This variant was found in 4/221932 control chromosomes from gnomAD at a frequency of 0.00001802, however this frequency may not be accurate since a duplication of this size may not be captured properly by gnomAD/ExAC and similar overlapping duplications are present at low frequencies. This variant is widely reported as a polymorphism found in general population in literature and generally forms a haplotype with other two polymorphisms P11L and I340M (Purdue_1991, Coulter-Mackie_2003, Wang_2016). Its reported allele frequencies in multiple ethnic backgrounds from publications are 6.5% in European controls (Purdue_1991), 9% in South African controls (Coulter-Mackie_2003) and 3% in Chinese controls (Wang_2016), however, all control cohorts in these studies are small with less than or equal to 200 control chromosomes. This variant or its haplotypic form has been reported in the same chromosome (in cis) with known pathogenic or likely pathogenic variants, such as G170R, A112D, and R333X (Coulter-Mackie_2003, Wang_2016), further supporting benign outcome. In addition, this variant is unlikely to affect splicing because stable AGT mRNA produced was derived from the haplotype comprising this variant, p.Pro11Leu and p.Ile340Met (Purdue_1991). Taken together, this variant is classified likely benign. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-1.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs180177174; hg19: chr2-241808460;