chr2-47369450-GCCCTCCCGCGAGTCCCGGGC-G

Variant names:

• chr2-47369450-GCCCTCCCGCGAGTCCCGGGC-G
• rs201752400
• NM_002354.3:c.-45_-26delAGTCCCGGGCCCCTCCCGCG

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP6_Moderate BA1

The NM_002354.3(EPCAM):​c.-45_-26delAGTCCCGGGCCCCTCCCGCG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00964 in 1,369,268 control chromosomes in the GnomAD database, including 722 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.041 (406 hom., cov: 32)
  • Exomes 𝑓: 0.0058 (316 hom.)
• Consequence: EPCAM NM_002354.3 5_prime_UTR
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.02
• Publications: 0 publications found

Genes affected

EPCAM (HGNC:11529): (epithelial cell adhesion molecule) This gene encodes a carcinoma-associated antigen and is a member of a family that includes at least two type I membrane proteins. This antigen is expressed on most normal epithelial cells and gastrointestinal carcinomas and functions as a homotypic calcium-independent cell adhesion molecule. The antigen is being used as a target for immunotherapy treatment of human carcinomas. Mutations in this gene result in congenital tufting enteropathy. [provided by RefSeq, Dec 2008]

EPCAM Gene-Disease associations (from GenCC):

• Lynch syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• Lynch syndrome 8

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• congenital diarrhea 5 with tufting enteropathy

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P, Orphanet
• hereditary breast carcinoma

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• BP6: Variant 2-47369450-GCCCTCCCGCGAGTCCCGGGC-G is Benign according to our data. Variant chr2-47369450-GCCCTCCCGCGAGTCCCGGGC-G is described in ClinVar as Benign. ClinVar VariationId is 1241098.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.134 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002354.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EPCAM	NM_002354.3	MANE Select	c.-45_-26delAGTCCCGGGCCCCTCCCGCG		5_prime_UTR	Exon 1 of 9	NP_002345.2	P16422

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EPCAM	ENST00000263735.9	TSL:1 MANE Select	c.-45_-26delAGTCCCGGGCCCCTCCCGCG		5_prime_UTR	Exon 1 of 9	ENSP00000263735.4	P16422
	EPCAM	ENST00000895681.1		c.-45_-26delAGTCCCGGGCCCCTCCCGCG		5_prime_UTR	Exon 1 of 9	ENSP00000565740.1
	EPCAM	ENST00000895685.1		c.-45_-26delAGTCCCGGGCCCCTCCCGCG		5_prime_UTR	Exon 1 of 9	ENSP00000565744.1

Frequencies

GnomAD3 genomes AF: 0.0405 AC: 6157 AN: 152062 Hom.: 402 Cov.: 32

Gnomad AFR AF: 0.137

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0148

Gnomad ASJ AF: 0.00893

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00435

Gnomad FIN AF: 0.00189

Gnomad MID AF: 0.0513

Gnomad NFE AF: 0.00179

Gnomad OTH AF: 0.0302

GnomAD4 exome AF: 0.00577 AC: 7019 AN: 1217098 Hom.: 316 AF XY: 0.00544 AC XY: 3222 AN XY: 591888

African (AFR) AF: 0.160 AC: 3926 AN: 24552

American (AMR) AF: 0.0193 AC: 270 AN: 14022

Ashkenazi Jewish (ASJ) AF: 0.0115 AC: 207 AN: 18008

East Asian (EAS) AF: 0.00 AC: 0 AN: 28380

South Asian (SAS) AF: 0.00822 AC: 467 AN: 56816

European-Finnish (FIN) AF: 0.00193 AC: 62 AN: 32122

Middle Eastern (MID) AF: 0.0177 AC: 62 AN: 3508

European-Non Finnish (NFE) AF: 0.00141 AC: 1393 AN: 989196

Other (OTH) AF: 0.0125 AC: 632 AN: 50494

GnomAD4 genome AF: 0.0406 AC: 6179 AN: 152170 Hom.: 406 Cov.: 32 AF XY: 0.0391 AC XY: 2909 AN XY: 74388

African (AFR) AF: 0.137 AC: 5682 AN: 41542

American (AMR) AF: 0.0148 AC: 226 AN: 15296

Ashkenazi Jewish (ASJ) AF: 0.00893 AC: 31 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5152

South Asian (SAS) AF: 0.00414 AC: 20 AN: 4828

European-Finnish (FIN) AF: 0.00189 AC: 20 AN: 10598

Middle Eastern (MID) AF: 0.0552 AC: 16 AN: 290

European-Non Finnish (NFE) AF: 0.00179 AC: 122 AN: 67972

Other (OTH) AF: 0.0294 AC: 62 AN: 2110

Alfa AF: 0.0247 Hom.: 26

Bravo AF: 0.0454

Asia WGS AF: 0.00984 AC: 35 AN: 3470

ClinVar

ClinVar submissions

Significance: Benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.0
Mutation Taster		=300/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs201752400; hg19: chr2-47596589;