chr2-47806544-T-TGGCTTTAATGCAGCAAGGCTTGCTAATCTCCCAGA

Variant names:

• chr2-47806544-T-TGGCTTTAATGCAGCAAGGCTTGCTAATCTCCCAGA
• rs1064793895
• NM_000179.3:c.3897_3931dupCTTTAATGCAGCAAGGCTTGCTAATCTCCCAGAGG

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_001406800.1(MSH6):​c.3884_3918dupCTTTAATGCAGCAAGGCTTGCTAATCTCCCAGAGG​(p.Lys1307LeufsTer2) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MSH6 NM_001406800.1 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 8.08

Genes affected

MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]

FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-47806544-T-TGGCTTTAATGCAGCAAGGCTTGCTAATCTCCCAGA is Pathogenic according to our data. Variant chr2-47806544-T-TGGCTTTAATGCAGCAAGGCTTGCTAATCTCCCAGA is described in ClinVar as [Pathogenic]. Clinvar id is 419474.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MSH6	NM_000179.3	c.3897_3931dupCTTTAATGCAGCAAGGCTTGCTAATCTCCCAGAGG	p.Glu1311AlafsTer28	frameshift_variant	Exon 9 of 10	ENST00000234420.11	NP_000170.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MSH6	ENST00000234420.11	c.3897_3931dupCTTTAATGCAGCAAGGCTTGCTAATCTCCCAGAGG	p.Glu1311AlafsTer28	frameshift_variant	Exon 9 of 10	1	NM_000179.3	ENSP00000234420.5

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 35

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:5

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:2

Sep 10, 2014

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

​The c.3897_3931dup35 pathogenic mutation, located in coding exon 9 of the MSH6 gene, results from a duplication of 35 nucleotides between position 3897 and 3931 causing a translational frameshift with a predicted alternate stop codon. Since frameshifts are typically deleterious in nature, this variant is interpreted as a disease-causing mutation (ACMG Recommendations for Standards for Interpretation and Reporting of Sequence Variations. Revision 2007. Genet Med 2008;10:294). -

Nov 13, 2020

Color Diagnostics, LLC DBA Color Health

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant inserts 35 nucleotides in exon 9 of the MSH6 gene, creating a frameshift and premature translation stop signal. This variant is expected to escape nonsense-mediated decay and be expressed as a non-functional truncated protein product lacking the part of ATPase domain (a.a. 1076-1360) and MSH2 binding domain (a.a. 1302-1360). To our knowledge, this variant has not been reported in individuals affected with hereditary cancer in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of MSH6 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic. -

Lynch syndrome 5 Pathogenic:1

Aug 28, 2023

Myriad Genetics, Inc.

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -

not provided Pathogenic:1

Jul 15, 2015

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This duplication of 35 nucleotides in MSH6 is denoted c.3897_3931dup35 at the cDNA level and p.Glu1311AlafsX28 (E1311AfsX28) at the protein level. The surrounding sequence is AGAGG[dup35]AAGT. The duplication causes a frameshift, which changes a Glutamic Acid to an Alanine at codon 1311, and creates a premature stop codon at position 28 of the new reading frame. Even though this frameshift occurs in the 3' end of the gene, it is significant since the last 50 correct amino acids are replaced by 27 incorrect ones. Although this variant has not, to our knowledge, been reported in the literature, it is predicted to cause loss of normal protein function through protein truncation and is located upstream of other frameshift variants; one specifically, MSH6 c.3984_3987dupGTCA, has been observed internally and published in several families with Lynch syndrome (Peterlongo 2003, Goldberg 2010, Raskin 2011). we consider this variant to be pathogenic. -

Hereditary nonpolyposis colorectal neoplasms Pathogenic:1

Apr 16, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the MSH6 protein in which other variant(s) (p.Leu1330Valfs*12) have been determined to be pathogenic (PMID: 14520694, 15236168, 16237223, 19851887, 21155762, 24440087, 26440929). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 419474). This variant has not been reported in the literature in individuals affected with MSH6-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Glu1311Alafs*28) in the MSH6 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 50 amino acid(s) of the MSH6 protein. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1064793895; hg19: chr2-48033683;