chr2-47806837-C-CTGACTTTGATTAAGGAATTATAGACTGACTACATTGGAAGCTT
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP6
The NM_000179.3(MSH6):c.4064_*23dupCTTTGATTAAGGAATTATAGACTGACTACATTGGAAGCTTTGA variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000301 in 1,460,250 control chromosomes in the GnomAD database, including 1 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). The gene MSH6 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000179.3 3_prime_UTR
Scores
Clinical Significance
Conservation
Publications
- intellectual developmental disorder with dysmorphic facies and behavioral abnormalitiesInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000179.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH6 | MANE Select | c.4064_*23dupCTTTGATTAAGGAATTATAGACTGACTACATTGGAAGCTTTGA | 3_prime_UTR | Exon 10 of 10 | NP_000170.1 | P52701-1 | |||
| MSH6 | c.4160_*23dupCTTTGATTAAGGAATTATAGACTGACTACATTGGAAGCTTTGA | 3_prime_UTR | Exon 11 of 11 | NP_001393724.1 | |||||
| MSH6 | c.4070_*23dupCTTTGATTAAGGAATTATAGACTGACTACATTGGAAGCTTTGA | 3_prime_UTR | Exon 10 of 10 | NP_001393742.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH6 | TSL:1 MANE Select | c.4064_*23dupCTTTGATTAAGGAATTATAGACTGACTACATTGGAAGCTTTGA | 3_prime_UTR | Exon 10 of 10 | ENSP00000234420.5 | P52701-1 | |||
| MSH6 | TSL:1 | n.*3411_*3453dupCTTTGATTAAGGAATTATAGACTGACTACATTGGAAGCTTTGA | non_coding_transcript_exon | Exon 9 of 9 | ENSP00000405294.1 | F8WAX8 | |||
| MSH6 | TSL:1 | n.*3411_*3453dupCTTTGATTAAGGAATTATAGACTGACTACATTGGAAGCTTTGA | 3_prime_UTR | Exon 9 of 9 | ENSP00000405294.1 | F8WAX8 |
Frequencies
GnomAD3 genomes AF: 0.0000268 AC: 4AN: 149478Hom.: 0 Cov.: 31 show subpopulations
GnomAD2 exomes AF: 0.0000478 AC: 12AN: 250978 AF XY: 0.0000737 show subpopulations
GnomAD4 exome AF: 0.0000301 AC: 44AN: 1460250Hom.: 1 Cov.: 32 AF XY: 0.0000468 AC XY: 34AN XY: 726468 show subpopulations
Age Distribution
GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000267 AC: 4AN: 149580Hom.: 0 Cov.: 31 AF XY: 0.0000137 AC XY: 1AN XY: 72740 show subpopulations
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at