chr21-44499743-CCCACCTGGCCACCCCAGTTGCTGCCGGGCAGCCGCGGCCTCAGCGTGTCCTCAG-C

Variant names:

• chr21-44499743-CCCACCTGGCCACCCCAGTTGCTGCCGGGCAGCCGCGGCCTCAGCGTGTCCTCAG-C
• NM_144991.3:c.1996_*39delCTGAGGACACGCTGAGGCCGCGGCTGCCCGGCAGCAACTGGGGTGGCCAGGTGG

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_144991.3(TSPEAR):​c.1996_*39delCTGAGGACACGCTGAGGCCGCGGCTGCCCGGCAGCAACTGGGGTGGCCAGGTGG​(p.Leu666_Ter670del) variant causes a stop lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000291 in 1,374,138 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000029 (0 hom.)
• Consequence: TSPEAR NM_144991.3 stop_lost, conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.386
• Publications: 0 publications found

Genes affected

TSPEAR (HGNC:1268): (thrombospondin type laminin G domain and EAR repeats) This gene encodes a protein that contains a N-terminal thrombospondin-type laminin G domain and several tandem arranged epilepsy-associated repeats (EARs). A mutation in this gene is the cause of autosomal recessive deafness-98. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]

TSPEAR Gene-Disease associations (from GenCC):

• ectodermal dysplasia 14, hair/tooth type with or without hypohidrosis

  Inheritance: AR Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• hearing loss, autosomal recessive

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal recessive nonsyndromic hearing loss 98

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• nonsyndromic genetic hearing loss

  Inheritance: AR Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Stoplost variant. No alternative stopcodon identified downstream, so we assume a Nonstop Mediated Decay. LoF is a known mechanism of disease.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_144991.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TSPEAR	NM_144991.3	MANE Select	c.1996_*39delCTGAGGACACGCTGAGGCCGCGGCTGCCCGGCAGCAACTGGGGTGGCCAGGTGG	p.Leu666_Ter670del	stop_lost conservative_inframe_deletion	Exon 12 of 12	NP_659428.2
	TSPEAR	NM_144991.3	MANE Select	c.1996_*39delCTGAGGACACGCTGAGGCCGCGGCTGCCCGGCAGCAACTGGGGTGGCCAGGTGG		3_prime_UTR	Exon 12 of 12	NP_659428.2
	TSPEAR	NM_001272037.2		c.1792_*39delCTGAGGACACGCTGAGGCCGCGGCTGCCCGGCAGCAACTGGGGTGGCCAGGTGG	p.Leu598_Ter602del	stop_lost conservative_inframe_deletion	Exon 13 of 13	NP_001258966.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TSPEAR	ENST00000323084.9	TSL:1 MANE Select	c.1996_*39delCTGAGGACACGCTGAGGCCGCGGCTGCCCGGCAGCAACTGGGGTGGCCAGGTGG	p.Leu666_Ter670del	stop_lost conservative_inframe_deletion	Exon 12 of 12	ENSP00000321987.4	Q8WU66-1
	TSPEAR	ENST00000323084.9	TSL:1 MANE Select	c.1996_*39delCTGAGGACACGCTGAGGCCGCGGCTGCCCGGCAGCAACTGGGGTGGCCAGGTGG		3_prime_UTR	Exon 12 of 12	ENSP00000321987.4	Q8WU66-1
	TSPEAR	ENST00000943283.1		c.2122_*39delCTGAGGACACGCTGAGGCCGCGGCTGCCCGGCAGCAACTGGGGTGGCCAGGTGG	p.Leu708_Ter712del	stop_lost conservative_inframe_deletion	Exon 13 of 13	ENSP00000613342.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD2 exomes AF: 0.00000767 AC: 1 AN: 130448 AF XY: 0.0000141

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000206

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000291 AC: 4 AN: 1374138 Hom.: 0 AF XY: 0.00000295 AC XY: 2 AN XY: 676940

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 30010

American (AMR) AF: 0.00 AC: 0 AN: 32910

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 23880

East Asian (EAS) AF: 0.00 AC: 0 AN: 34348

South Asian (SAS) AF: 0.00 AC: 0 AN: 77196

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 46010

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4050

European-Non Finnish (NFE) AF: 0.00000374 AC: 4 AN: 1068948

Other (OTH) AF: 0.00 AC: 0 AN: 56786

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0000222786), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.39

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr21-45919626;