chr21-46002695-GCCCAGATCTGCATAGGTGCGCATGGGGCCACCCGGGCAGT-G
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_001848.3(COL6A1):c.2431_2434+36delATAGGTGCGCATGGGGCCACCCGGGCAGTCCCAGATCTGC(p.Ile811ProfsTer103) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000131 in 152,198 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001848.3 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- collagen 6-related myopathyInheritance: AD, AR Classification: DEFINITIVE Submitted by: ClinGen
- Bethlem myopathy 1AInheritance: AR, AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, G2P
- Ullrich congenital muscular dystrophy 1AInheritance: AD, AR Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- Bethlem myopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Ullrich congenital muscular dystrophyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001848.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL6A1 | NM_001848.3 | MANE Select | c.2431_2434+36delATAGGTGCGCATGGGGCCACCCGGGCAGTCCCAGATCTGC | p.Ile811ProfsTer103 | frameshift splice_donor splice_region intron | Exon 33 of 35 | NP_001839.2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL6A1 | ENST00000361866.8 | TSL:1 MANE Select | c.2420_2434+25delCCCAGATCTGCATAGGTGCGCATGGGGCCACCCGGGCAGT | p.Ala807_Ile811del | splice_donor disruptive_inframe_deletion splice_region intron | Exon 33 of 35 | ENSP00000355180.3 | ||
| COL6A1 | ENST00000498614.5 | TSL:1 | n.654_668+25delCCCAGATCTGCATAGGTGCGCATGGGGCCACCCGGGCAGT | splice_donor splice_region intron non_coding_transcript_exon | Exon 4 of 6 | ||||
| COL6A1 | ENST00000866134.1 | c.734_748+25delCCCAGATCTGCATAGGTGCGCATGGGGCCACCCGGGCAGT | p.Ala245_Ile249del | splice_donor disruptive_inframe_deletion splice_region intron | Exon 5 of 7 | ENSP00000536193.1 |
Frequencies
GnomAD3 genomes AF: 0.0000131 AC: 2AN: 152198Hom.: 0 Cov.: 35 show subpopulations
GnomAD2 exomes AF: 0.0000161 AC: 4AN: 248576 AF XY: 0.0000149 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000821 AC: 12AN: 1460980Hom.: 0 AF XY: 0.00000550 AC XY: 4AN XY: 726784 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.0000131 AC: 2AN: 152198Hom.: 0 Cov.: 35 AF XY: 0.00 AC XY: 0AN XY: 74338 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at