chr3-10141787-C-CCCCGCGTCCGACCCGCGGAT

Variant names:

• chr3-10141787-C-CCCCGCGTCCGACCCGCGGAT
• rs730882036
• NM_000551.4:c.-54_-35dupTCCGACCCGCGGATCCCGCG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_000551.4(VHL):​c.-54_-35dupTCCGACCCGCGGATCCCGCG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000729 in 1,372,178 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 7.3e-7 (0 hom.)
• Consequence: VHL NM_000551.4 5_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2 B:1
• Conservation: PhyloP100: 0.552
• Publications: 1 publications found

Genes affected

VHL (HGNC:12687): (von Hippel-Lindau tumor suppressor) This gene encodes a component of a ubiquitination complex. The encoded protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. In addition to oxygen-related gene expression, this protein plays a role in many other cellular processes including cilia formation, cytokine signaling, regulation of senescence, and formation of the extracellular matrix. Variants of this gene are associated with von Hippel-Lindau syndrome, pheochromocytoma, erythrocytosis, renal cell carcinoma, and cerebellar hemangioblastoma. [provided by RefSeq, Jun 2022]

VHL Gene-Disease associations (from GenCC):

• pheochromocytoma

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• von Hippel-Lindau disease

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, Genomics England PanelApp, G2P
• renal cell carcinoma

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• autosomal recessive secondary polycythemia not associated with VHL gene

  Inheritance: AR Classification: STRONG Submitted by: Ambry Genetics
• Chuvash polycythemia

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
• hereditary pheochromocytoma-paraganglioma

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000551.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	VHL	NM_000551.4	MANE Select	c.-54_-35dupTCCGACCCGCGGATCCCGCG		5_prime_UTR	Exon 1 of 3	NP_000542.1	A0A024R2F2
	VHL	NM_001354723.2		c.-54_-35dupTCCGACCCGCGGATCCCGCG		5_prime_UTR	Exon 1 of 3	NP_001341652.1	A0A8Q3WL21
	VHL	NM_198156.3		c.-54_-35dupTCCGACCCGCGGATCCCGCG		5_prime_UTR	Exon 1 of 2	NP_937799.1	A0A0S2Z4K1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	VHL	ENST00000256474.3	TSL:1 MANE Select	c.-54_-35dupTCCGACCCGCGGATCCCGCG		5_prime_UTR	Exon 1 of 3	ENSP00000256474.3	P40337-1
	VHL	ENST00000345392.3	TSL:1	c.-54_-35dupTCCGACCCGCGGATCCCGCG		5_prime_UTR	Exon 1 of 2	ENSP00000344757.2	P40337-2
	VHL	ENST00000477538.2	TSL:1	n.-8_12dupTCCGACCCGCGGATCCCGCG		non_coding_transcript_exon	Exon 1 of 3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 7.29e-7 AC: 1 AN: 1372178 Hom.: 0 Cov.: 30 AF XY: 0.00 AC XY: 0 AN XY: 676586

African (AFR) AF: 0.00 AC: 0 AN: 30642

American (AMR) AF: 0.00 AC: 0 AN: 34178

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24678

East Asian (EAS) AF: 0.00 AC: 0 AN: 35310

South Asian (SAS) AF: 0.00 AC: 0 AN: 78166

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 46464

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4024

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1061924

Other (OTH) AF: 0.0000176 AC: 1 AN: 56792

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Hereditary cancer-predisposing syndrome (1)
-	-	1	VHL-related disorder (1)
-	1	-	Von Hippel-Lindau syndrome;C1837915:Chuvash polycythemia (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.55

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs730882036; hg19: chr3-10183471;