chr3-10141787-C-CCCCGCGTCCGACCCGCGGAT
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM2
The NM_000551.4(VHL):c.-54_-35dupTCCGACCCGCGGATCCCGCG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000729 in 1,372,178 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_000551.4 5_prime_UTR
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
VHL | NM_000551.4 | c.-54_-35dupTCCGACCCGCGGATCCCGCG | 5_prime_UTR_variant | Exon 1 of 3 | ENST00000256474.3 | NP_000542.1 | ||
VHL | NM_001354723.2 | c.-54_-35dupTCCGACCCGCGGATCCCGCG | 5_prime_UTR_variant | Exon 1 of 3 | NP_001341652.1 | |||
VHL | NM_198156.3 | c.-54_-35dupTCCGACCCGCGGATCCCGCG | 5_prime_UTR_variant | Exon 1 of 2 | NP_937799.1 | |||
VHL | NR_176335.1 | n.17_36dupTCCGACCCGCGGATCCCGCG | non_coding_transcript_exon_variant | Exon 1 of 4 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome AF: 7.29e-7 AC: 1AN: 1372178Hom.: 0 Cov.: 30 AF XY: 0.00 AC XY: 0AN XY: 676586 show subpopulations
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Von Hippel-Lindau syndrome;C1837915:Chuvash polycythemia Uncertain:1
This variant occurs in a non-coding region of the VHL gene. It does not change the encoded amino acid sequence of the VHL protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with VHL-related conditions. ClinVar contains an entry for this variant (Variation ID: 182985). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Hereditary cancer-predisposing syndrome Uncertain:1
This duplication of 20 nucleotides is denoted VHL c.-35_-34insTCCGACCCGCGGATCCCGCG (aka c.-54_-35dup20), and describes a duplication upstream of the VHL ATG translational start site in the 5' untranslated region (UTR). The surrounding sequence is CGCG{dup20}GCGT. This variant has not, to our knowledge, been published in the literature as either a mutation or a benign polymorphism and does not appear to affect the start codon or the Kozak translational consensus sequence. At this time, we consider VHL c.-54_-35dup20 to be a variant of unknown significance. The variant is found in MODRISK-HEREDICV3 panel(s). -
VHL-related disorder Benign:1
This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at