chr3-10141787-C-CCCCGCGTCCGACCCGCGGAT

Variant names:

• chr3-10141787-C-CCCCGCGTCCGACCCGCGGAT
• rs730882036
• NM_000551.4:c.-54_-35dupTCCGACCCGCGGATCCCGCG

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_000551.4(VHL):​c.-54_-35dupTCCGACCCGCGGATCCCGCG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000729 in 1,372,178 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 7.3e-7 (0 hom.)
• Consequence: VHL NM_000551.4 5_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2 B:1
• Conservation: PhyloP100: 0.552

Genes affected

VHL (HGNC:12687): (von Hippel-Lindau tumor suppressor) This gene encodes a component of a ubiquitination complex. The encoded protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. In addition to oxygen-related gene expression, this protein plays a role in many other cellular processes including cilia formation, cytokine signaling, regulation of senescence, and formation of the extracellular matrix. Variants of this gene are associated with von Hippel-Lindau syndrome, pheochromocytoma, erythrocytosis, renal cell carcinoma, and cerebellar hemangioblastoma. [provided by RefSeq, Jun 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
VHL	NM_000551.4	c.-54_-35dupTCCGACCCGCGGATCCCGCG		5_prime_UTR_variant	Exon 1 of 3	ENST00000256474.3	NP_000542.1
VHL	NM_001354723.2	c.-54_-35dupTCCGACCCGCGGATCCCGCG		5_prime_UTR_variant	Exon 1 of 3		NP_001341652.1
VHL	NM_198156.3	c.-54_-35dupTCCGACCCGCGGATCCCGCG		5_prime_UTR_variant	Exon 1 of 2		NP_937799.1
VHL	NR_176335.1	n.17_36dupTCCGACCCGCGGATCCCGCG		non_coding_transcript_exon_variant	Exon 1 of 4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
VHL	ENST00000256474	c.-54_-35dupTCCGACCCGCGGATCCCGCG		5_prime_UTR_variant	Exon 1 of 3	1	NM_000551.4	ENSP00000256474.3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 7.29e-7 AC: 1 AN: 1372178 Hom.: 0 Cov.: 30 AF XY: 0.00 AC XY: 0 AN XY: 676586

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.0000176

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2 Benign:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Von Hippel-Lindau syndrome;C1837915:Chuvash polycythemia Uncertain:1

Jun 25, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant occurs in a non-coding region of the VHL gene. It does not change the encoded amino acid sequence of the VHL protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with VHL-related conditions. ClinVar contains an entry for this variant (Variation ID: 182985). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Hereditary cancer-predisposing syndrome Uncertain:1

Sep 16, 2014

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This duplication of 20 nucleotides is denoted VHL c.-35_-34insTCCGACCCGCGGATCCCGCG (aka c.-54_-35dup20), and describes a duplication upstream of the VHL ATG translational start site in the 5' untranslated region (UTR). The surrounding sequence is CGCG{dup20}GCGT. This variant has not, to our knowledge, been published in the literature as either a mutation or a benign polymorphism and does not appear to affect the start codon or the Kozak translational consensus sequence. At this time, we consider VHL c.-54_-35dup20 to be a variant of unknown significance. The variant is found in MODRISK-HEREDICV3 panel(s). -

VHL-related disorder Benign:1

Apr 15, 2022

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs730882036; hg19: chr3-10183471;