chr3-179401325-AAAAAAATTCAGTAAAAAATTGGCAATTGTAGGGTTTTAGAATT-A

Position:

• chr3-179401325-AAAAAAATTCAGTAAAAAATTGGCAATTGTAGGGTTTTAGAATT-A

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM2 BP6_Moderate

The NM_021629.4(GNB4):​c.917-49_917-7delAATTCTAAAACCCTACAATTGCCAATTTTTTACTGAATTTTTT variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000689 in 1,450,684 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.9e-7 (0 hom.)
• Consequence: GNB4 NM_021629.4 splice_region, intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.18

Genes affected

GNB4 (HGNC:20731): (G protein subunit beta 4) Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP6: Variant 3-179401325-AAAAAAATTCAGTAAAAAATTGGCAATTGTAGGGTTTTAGAATT-A is Benign according to our data. Variant chr3-179401325-AAAAAAATTCAGTAAAAAATTGGCAATTGTAGGGTTTTAGAATT-A is described in ClinVar as [Likely_benign]. Clinvar id is 1549037.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
GNB4	NM_021629.4	c.917-49_917-7delAATTCTAAAACCCTACAATTGCCAATTTTTTACTGAATTTTTT		splice_region_variant, intron_variant		ENST00000232564.8	NP_067642.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
GNB4	ENST00000232564.8	c.917-49_917-7delAATTCTAAAACCCTACAATTGCCAATTTTTTACTGAATTTTTT		splice_region_variant, intron_variant		1	NM_021629.4	ENSP00000232564.3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 6.89e-7 AC: 1 AN: 1450684 Hom.: 0 AF XY: 0.00000139 AC XY: 1 AN XY: 721804

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 9.05e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

Charcot-Marie-Tooth disease dominant intermediate F Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Apr 13, 2021

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-179119113;