chr3-183020101-ACATCATTCTACAGATGTCATGTGATTACCTTTT-A
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_020166.5(MCCC1):c.1973_1977+28delAAAAGGTAATCACATGACATCTGTAGAATGATG(p.Glu658fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_020166.5 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 18 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MCCC1 | NM_020166.5 | c.1973_1977+28delAAAAGGTAATCACATGACATCTGTAGAATGATG | p.Glu658fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 17 of 19 | ENST00000265594.9 | NP_064551.3 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD3 exomes AF: 0.00000400 AC: 1AN: 250084Hom.: 0 AF XY: 0.00000740 AC XY: 1AN XY: 135182
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
not provided Pathogenic:1
- -
3-methylcrotonyl-CoA carboxylase 1 deficiency Pathogenic:1
This variant results in the deletion of the last 5 nucleotides of exon 17 and affects a donor splice site in intron 17 of the MCCC1 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in MCCC1 are known to be pathogenic (PMID: 11181649, 15359379, 22642865). This variant is present in population databases (rs776641008, gnomAD 0.003%). This variant has not been reported in the literature in individuals affected with MCCC1-related conditions. ClinVar contains an entry for this variant (Variation ID: 498130). For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at