chr3-186783602-TTTCGGATCATGTCTGGTGGC-T
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong
The NM_001967.4(EIF4A2):c.-7_13delTCGGATCATGTCTGGTGGCT(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001967.4 frameshift, start_lost
Scores
Clinical Significance
Conservation
Publications
- neurodevelopmental disorder with hypotonia and speech delay, with or without seizuresInheritance: AR, AD Classification: STRONG, MODERATE, LIMITED Submitted by: G2P, Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001967.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| EIF4A2 | TSL:1 MANE Select | c.-7_13delTCGGATCATGTCTGGTGGCT | p.Met1fs | frameshift start_lost | Exon 1 of 11 | ENSP00000326381.5 | Q14240-1 | ||
| EIF4A2 | TSL:1 | c.-7_13delTCGGATCATGTCTGGTGGCT | p.Met1fs | frameshift start_lost | Exon 1 of 11 | ENSP00000398370.2 | Q14240-2 | ||
| EIF4A2 | TSL:1 MANE Select | c.-7_13delTCGGATCATGTCTGGTGGCT | 5_prime_UTR | Exon 1 of 11 | ENSP00000326381.5 | Q14240-1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at